معلومة

قضية RNase و EtOH


أنا أعمل مع RNA ولدي بعض مشكلات RNase. على سبيل المثال ، أنا أستخدم مجموعة RNeasy الصغيرة وفي خطوة واحدة أستخدم 100٪ EtOH. لا تقول أنها خالية من RNase أم لا. هل يثبط EtOH المطلق أو يزيل RNase أم يجب أن أقلق بشأنه؟

إضافة: أنا أستخدم eppendorfs مباشرة من الحقيبة. لذلك من المفترض أن يكونوا خاليين من RNase ، أليس كذلك؟

شكرا.


الإيثانول ليس مشكلة ، فنحن نستخدمه دون أي احتياطات أخرى ويبدو أنه خالٍ من RNAse. يجب أن تتخذ الاحتياطات المعتادة التي يجب أن تتخذها مع جميع المواد الكيميائية عند العمل مع الحمض النووي الريبي ، ولا تستخدم أبدًا ملعقة أو ملعقة لإخراج أي شيء من الزجاجة (إلا إذا كنت ترغب في خبز الملاعق الخاصة بك طوال الوقت) ، قم دائمًا بصبها لتجنب أي شيء. تلوث اشعاعى.

لقد قمنا بتعقيم Eppis مرة واحدة ، قد يكون هذا إجراء احترازي غير ضروري. أعتقد أنه يمكنك أيضًا شرائها مجانًا من RNAse ، لكنني لست متأكدًا مما إذا كانت قد عولجت بالفعل بطريقة مختلفة أو ببساطة أكثر تكلفة.


ما هو الغرض من الإيثانول في استخراج الحمض النووي؟

يستخدم الإيثانول في استخراج الحمض النووي لإجبار الحمض النووي على التعجيل في محلول. من أجل جمع عينة من الحمض النووي ، يتم تفكيك الخلايا من خلال التحريض ، ثم خلطها بالماء والملح والإيثانول لتكوين محلول مائي. يعمل الإيثانول والملح على منع الحمض النووي من الذوبان في الماء ، وبدلاً من ذلك يتسبب في ترسبه بحيث يمكن فصله واستخراجه باستخدام جهاز طرد مركزي.

بدون إضافة أي من الإيثانول أو كحول آخر مثل الأيزوبروبانول ، سيذوب الحمض النووي في الماء. هذا لأن الأحماض النووية (مثل الحمض النووي) محبة للماء ، مما يعني أنها ترتبط بسهولة بجزيئات H2O. يتفاعل الملح ، الذي يستخدم مع الإيثانول لإجبار الحمض النووي على الترسب ، مع جزيئات الحمض النووي لجعله أقل محبة للماء. يسهل الإيثانول حدوث هذا التفاعل.

الحمض النووي محب للماء بسبب مجموعات الفوسفات سالبة الشحنة الموجودة على طول العمود الفقري لفوسفات السكر. تتفاعل مجموعات الفوسفات سالبة الشحنة هذه مع ذرات الهيدروجين موجبة الشحنة في جزيئات الماء. يمنع الملح هذه العملية. عندما يذوب في الماء ، فإن أحد منتجات الملح هو Na + ، أيون الصوديوم موجب الشحنة. تعمل أيونات الصوديوم موجبة الشحنة على تحييد الشحنة السالبة لمجموعات فوسفات الحمض النووي.

لا يكفي الماء وحده للسماح بالتفاعل بين أيونات الصوديوم ومجموعات الفوسفات ، حيث يمنع الماء التجاذب الكهروستاتيكي بين الاثنين. يسمح الإيثانول بحدوث هذا التفاعل ، مما يسمح لأيونات الصوديوم بحماية مجموعات الفوسفات السالبة والتسبب في ترسب الحمض النووي خارج المحلول.


المواد والأساليب

السلالات البكتيرية وظروف النمو

يتم سرد السلالات المستخدمة في هذه الدراسة في الجدول 1. بكتريا المكورة العنقودية البرتقالية نمت السلالات في وسط CYPG (10 جم لتر من أحماض الكازامينو ، 10 جم لتر -1 مستخلص الخميرة ، 5 جم لتر كلوريد الصوديوم ، 0.5٪ وزن / حجم جلوكوز و 0.06 مولار فوسفوجليسيرات) (31). بالنسبة للسلالات التي تحمل جينات مقاومة ، تم استخدام المضادات الحيوية فقط في الثقافات الليلية بالتركيزات التالية: 10 ميكروغرام مل -1 إريثروميسين ، 5 ميكروغرام مل -1 تتراسيكلين و 10 ميكروغرام مل كلورامفينيكول. تم تخفيف البكتيريا من الثقافات الليلية إلى كثافة بصرية أولية عند 600 نانومتر (OD 600) من 0.05 في وسط جديد ونمت بالاهتزاز عند 220 دورة في الدقيقة عند 37 درجة مئوية إلى مرحلة النمو الأسي.

السلالات البكتيرية والبلازميدات

سلالة أو بلازميد. وصف . المرجعي .
سلالات
بكتريا قولونية
أعلى 10 مختص بكتريا قولونية للتحول البلازميد إنفيتروجين
DC10B مختص بكتريا قولونية للتحول المباشر للبلازميد إلى عزلات إكلينيكية من بكتريا المكورة العنقودية البرتقالية (46)
BL21 (DE3) بكتريا قولونية للتعبير عن البروتينات المؤتلفة مع IPTG بروميغا
بكتريا المكورة العنقودية البرتقالية
ISP479C المشتق 8325-4 مع SaeS L allele ( 47)
سي إل 316 RN4220 (pYL112 - 19) ، L54 int الجين ( 34)
RN4220 نقص القيود بكتريا المكورة العنقودية البرتقالية أضنى ( 48)
RN4220-30 RN4220 saeP :: kanAهذا العمل
RN4220-217 RN4220 rny::ermC( 11)
رجل جديد النوع البري ( 49)
نيومان 29 رجل جديد، sae :: kanA( 20)
نيومان 30 رجل جديد saeP :: kanAهذه الدراسة
نيومان -217 رجل جديد rny::ermC( 11)
نيومان -217-30 رجل جديد rny::ermC، saeP :: kanAهذا العمل
PR01 ΔpyrFE متحولة من السلالة السريرية SA564RD ( 39)
PR01-01 PR01 مع الجين RNase J1 محذوف ( 39)
البلازميدات
لبناء متحولة SaeP
pMAD ناقل لاستبدال الأليلات ( 33)
pBT2 ناقلات الاستنساخ ( 31)
30 pMAD مع المستنسخة saeP :: kanAهذه الدراسة
لقالب PCR
pCWsae19 pCR2.1-Topo مع saePQRS مع وقف كودون في سايب(تي جيجر ، غير منشور)
البلازميدات التكاملية
pCG188 pCL84 مع اقتطاع gfp كاسيت الجينات من pc183 ( 11)
pCG212 pCG188 مع م المنطقة من P1 إلى المنبع من P3 ( 11)
pCG213 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف 13 نقطة أساس في CS هذا العمل
pCG218 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقة الجذعية اليسرى (فاصل) هذا العمل
pCG219 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقة الجذعية اليمنى هذا العمل
pCG223 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف المنطقة بأكملها بين الحلقات الجذعية هذا العمل
pCG379 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقتين الجذعية هذا العمل
pCG301 pCG188 مع م المنطقة بين الحلقتين الجذعية تحت مروج P1 الأصلي هذا العمل
pCG392 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف تسلسل المصب CS (Rrs) هذا العمل
pCG394 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف CS والبديل CS (aCS) هذا العمل
pCG484 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف نظير Rrs هذا العمل
pCG589 pCG212 مع م منطقة بها CS متحولة (C بدلاً من T) هذا العمل
البلازميدات المتماثلة
pCG246 بكتريا قولونية/ ناقلات المكوك العنقودية ، مشتق pCN47 مع قط كاسيت ( 50)
pCG599 pCG246 مع sae-gfp المنطقة من البلازميد pCG212 هذا العمل
pCG600 pCG246 مع sae-gfp المنطقة من البلازميد pCG484 هذا العمل
pCG601 pCG246 مع sae-gfp المنطقة من البلازميد pCG392 هذا العمل
pCG616 pCG246 مع sae-gfp المنطقة من البلازميد pCG589 هذا العمل
pCG618 pCG599 مع م المنطقة ذات الطفرة النقطية التي تؤثر على البنية الثانوية Rrs: CC في +3 و +8 بدلاً من AA ، CC في +14 و +15 بدلاً من TT (يشار إلى الموضع على أنه مسافة إلى موقع الانقسام) هذا العمل
pCG620 pCG246 مع sae-gfp المنطقة من البلازميد pCG223 هذا العمل
للتكامل
pCG296 pCG246 مع rny للتكامل ( 11)
pCG322 pCG246 مع rny بدون موقع نشط للتكامل هذا العمل
pCG596 pCG246 مع rny تحمل الطفرات في الموقع النشط (H367A D368A) هذا العمل
لتنقية البروتين
pET15b ناقل التعبير البروتيني ، تحريض IPTG نوفاجين
pCG249 pET15b مع rny (بدون مجال الغشاء) هذا العمل
سلالة أو بلازميد. وصف . المرجعي .
سلالات
بكتريا قولونية
أعلى 10 مختص بكتريا قولونية للتحول البلازميد إنفيتروجين
DC10B مختص بكتريا قولونية للتحول المباشر للبلازميد إلى عزلات إكلينيكية من بكتريا المكورة العنقودية البرتقالية (46)
BL21 (DE3) بكتريا قولونية للتعبير عن البروتينات المؤتلفة مع IPTG بروميغا
بكتريا المكورة العنقودية البرتقالية
ISP479C المشتق 8325-4 مع SaeS L allele ( 47)
سي إل 316 RN4220 (pYL112 - 19) ، L54 int الجين ( 34)
RN4220 نقص القيود بكتريا المكورة العنقودية البرتقالية أضنى ( 48)
RN4220-30 RN4220 saeP :: kanAهذا العمل
RN4220-217 RN4220 rny::ermC( 11)
رجل جديد النوع البري ( 49)
نيومان 29 رجل جديد، sae :: kanA( 20)
نيومان 30 رجل جديد saeP :: kanAهذه الدراسة
نيومان -217 رجل جديد rny::ermC( 11)
نيومان -217-30 رجل جديد rny::ermC، saeP :: kanAهذا العمل
PR01 ΔpyrFE متحولة من السلالة السريرية SA564RD ( 39)
PR01-01 PR01 مع الجين RNase J1 محذوف ( 39)
البلازميدات
لبناء متحولة SaeP
pMAD ناقل لاستبدال الأليلات ( 33)
pBT2 ناقلات الاستنساخ ( 31)
30 pMAD مع المستنسخة saeP :: kanAهذه الدراسة
لقالب PCR
pCWsae19 pCR2.1-Topo مع saePQRS مع وقف كودون في سايب(تي جيجر ، غير منشور)
البلازميدات التكاملية
pCG188 pCL84 مع اقتطاع gfp كاسيت الجينات من pc183 ( 11)
pCG212 pCG188 مع م المنطقة من P1 إلى المنبع من P3 ( 11)
pCG213 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف 13 نقطة أساس في CS هذا العمل
pCG218 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقة الجذعية اليسرى (فاصل) هذا العمل
pCG219 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقة الجذعية اليمنى هذا العمل
pCG223 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف المنطقة بأكملها بين الحلقات الجذعية هذا العمل
pCG379 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقتين الجذعية هذا العمل
pCG301 pCG188 مع م المنطقة بين الحلقتين الجذعية تحت مروج P1 الأصلي هذا العمل
pCG392 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف تسلسل المصب CS (Rrs) هذا العمل
pCG394 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف CS والبديل CS (aCS) هذا العمل
pCG484 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف نظير Rrs هذا العمل
pCG589 pCG212 مع م منطقة بها CS متحولة (C بدلاً من T) هذا العمل
البلازميدات المتماثلة
pCG246 بكتريا قولونية/ ناقلات المكوك العنقودية ، مشتق pCN47 مع قط كاسيت ( 50)
pCG599 pCG246 مع sae-gfp المنطقة من البلازميد pCG212 هذا العمل
pCG600 pCG246 مع sae-gfp المنطقة من البلازميد pCG484 هذا العمل
pCG601 pCG246 مع sae-gfp المنطقة من البلازميد pCG392 هذا العمل
pCG616 pCG246 مع sae-gfp المنطقة من البلازميد pCG589 هذا العمل
pCG618 pCG599 مع م المنطقة ذات الطفرة النقطية التي تؤثر على بنية Rrs الثانوية: CC في +3 و +8 بدلاً من AA ، و CC في +14 و +15 بدلاً من TT (يشار إلى الموضع على أنه مسافة إلى موقع الانقسام) هذا العمل
pCG620 pCG246 مع sae-gfp المنطقة من البلازميد pCG223 هذا العمل
للتكامل
pCG296 pCG246 مع rny للتكامل ( 11)
pCG322 pCG246 مع rny بدون موقع نشط للتكامل هذا العمل
pCG596 pCG246 مع rny تحمل الطفرات في الموقع النشط (H367A D368A) هذا العمل
لتنقية البروتين
pET15b ناقل التعبير البروتيني ، تحريض IPTG نوفاجين
pCG249 pET15b مع rny (بدون مجال الغشاء) هذا العمل
سلالة أو بلازميد. وصف . المرجعي .
سلالات
بكتريا قولونية
أعلى 10 مختص بكتريا قولونية للتحول البلازميد إنفيتروجين
DC10B مختص بكتريا قولونية للتحول المباشر للبلازميد إلى عزلات إكلينيكية من بكتريا المكورة العنقودية البرتقالية (46)
BL21 (DE3) بكتريا قولونية للتعبير عن البروتينات المؤتلفة مع IPTG بروميغا
بكتريا المكورة العنقودية البرتقالية
ISP479C المشتق 8325-4 مع SaeS L allele ( 47)
سي إل 316 RN4220 (pYL112 - 19) ، L54 int الجين ( 34)
RN4220 نقص القيود بكتريا المكورة العنقودية البرتقالية أضنى ( 48)
RN4220-30 RN4220 saeP :: kanAهذا العمل
RN4220-217 RN4220 rny::ermC( 11)
رجل جديد النوع البري ( 49)
نيومان 29 رجل جديد، sae :: kanA( 20)
نيومان 30 رجل جديد saeP :: kanAهذه الدراسة
نيومان -217 رجل جديد rny::ermC( 11)
نيومان -217-30 رجل جديد rny::ermC، saeP :: kanAهذا العمل
PR01 ΔpyrFE متحولة من السلالة السريرية SA564RD ( 39)
PR01-01 PR01 مع الجين RNase J1 محذوف ( 39)
البلازميدات
لبناء متحولة SaeP
pMAD ناقل لاستبدال الأليلات ( 33)
pBT2 ناقلات الاستنساخ ( 31)
30 pMAD مع المستنسخة saeP :: kanAهذه الدراسة
لقالب PCR
pCWsae19 pCR2.1-Topo مع saePQRS مع وقف كودون في سايب(تي جيجر ، غير منشور)
البلازميدات التكاملية
pCG188 pCL84 مع اقتطاع gfp كاسيت الجينات من pc183 ( 11)
pCG212 pCG188 مع م المنطقة من P1 إلى المنبع من P3 ( 11)
pCG213 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف 13 نقطة أساس في CS هذا العمل
pCG218 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقة الجذعية اليسرى (فاصل) هذا العمل
pCG219 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقة الجذعية اليمنى هذا العمل
pCG223 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف المنطقة بأكملها بين الحلقات الجذعية هذا العمل
pCG379 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقتين الجذعية هذا العمل
pCG301 pCG188 مع م المنطقة بين الحلقتين الجذعية تحت مروج P1 الأصلي هذا العمل
pCG392 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف التسلسل المصب لـ CS (Rrs) هذا العمل
pCG394 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف CS والبديل CS (aCS) هذا العمل
pCG484 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف نظير Rrs هذا العمل
pCG589 pCG212 مع م منطقة بها CS متحولة (C بدلاً من T) هذا العمل
البلازميدات المتماثلة
pCG246 بكتريا قولونية/ ناقلات المكوك العنقودية ، مشتق pCN47 مع قط كاسيت ( 50)
pCG599 pCG246 مع sae-gfp المنطقة من البلازميد pCG212 هذا العمل
pCG600 pCG246 مع sae-gfp المنطقة من البلازميد pCG484 هذا العمل
pCG601 pCG246 مع sae-gfp المنطقة من البلازميد pCG392 هذا العمل
pCG616 pCG246 مع sae-gfp المنطقة من البلازميد pCG589 هذا العمل
pCG618 pCG599 مع م المنطقة ذات الطفرة النقطية التي تؤثر على بنية Rrs الثانوية: CC في +3 و +8 بدلاً من AA ، و CC في +14 و +15 بدلاً من TT (يشار إلى الموضع على أنه مسافة إلى موقع الانقسام) هذا العمل
pCG620 pCG246 مع sae-gfp المنطقة من البلازميد pCG223 هذا العمل
للتكامل
pCG296 pCG246 مع rny للتكامل ( 11)
pCG322 pCG246 مع rny بدون موقع نشط للتكامل هذا العمل
pCG596 pCG246 مع rny تحمل الطفرات في الموقع النشط (H367A D368A) هذا العمل
لتنقية البروتين
pET15b ناقل التعبير البروتيني ، تحريض IPTG نوفاجين
pCG249 pET15b مع rny (بدون مجال الغشاء) هذا العمل
سلالة أو بلازميد. وصف . المرجعي .
سلالات
بكتريا قولونية
أعلى 10 مختص بكتريا قولونية للتحول البلازميد إنفيتروجين
DC10B مختص بكتريا قولونية للتحول المباشر للبلازميد إلى عزلات إكلينيكية من بكتريا المكورة العنقودية البرتقالية (46)
BL21 (DE3) بكتريا قولونية للتعبير عن البروتينات المؤتلفة مع IPTG بروميغا
بكتريا المكورة العنقودية البرتقالية
ISP479C المشتق 8325-4 مع SaeS L allele ( 47)
سي إل 316 RN4220 (pYL112 - 19) ، L54 int الجين ( 34)
RN4220 نقص القيود بكتريا المكورة العنقودية البرتقالية أضنى ( 48)
RN4220-30 RN4220 saeP :: kanAهذا العمل
RN4220-217 RN4220 rny::ermC( 11)
رجل جديد النوع البري ( 49)
نيومان 29 رجل جديد، sae :: kanA( 20)
نيومان 30 رجل جديد saeP :: kanAهذه الدراسة
نيومان -217 رجل جديد rny::ermC( 11)
نيومان -217-30 رجل جديد rny::ermC، saeP :: kanAهذا العمل
PR01 ΔpyrFE متحولة من السلالة السريرية SA564RD ( 39)
PR01-01 PR01 مع الجين RNase J1 محذوف ( 39)
البلازميدات
لبناء متحولة SaeP
pMAD ناقل لاستبدال الأليلات ( 33)
pBT2 ناقلات الاستنساخ ( 31)
30 pMAD مع المستنسخة saeP :: kanAهذه الدراسة
لقالب PCR
pCWsae19 pCR2.1-Topo مع saePQRS مع وقف كودون في سايب(تي جيجر ، غير منشور)
البلازميدات التكاملية
pCG188 pCL84 مع اقتطاع gfp كاسيت الجينات من pc183 ( 11)
pCG212 pCG188 مع م المنطقة من P1 إلى المنبع من P3 ( 11)
pCG213 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف 13 نقطة أساس في CS هذا العمل
pCG218 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقة الجذعية اليسرى (فاصل) هذا العمل
pCG219 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقة الجذعية اليمنى هذا العمل
pCG223 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف المنطقة بأكملها بين الحلقات الجذعية هذا العمل
pCG379 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف الحلقتين الجذعية هذا العمل
pCG301 pCG188 مع م المنطقة بين الحلقتين الجذعية تحت مروج P1 الأصلي هذا العمل
pCG392 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف تسلسل المصب CS (Rrs) هذا العمل
pCG394 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف CS والبديل CS (aCS) هذا العمل
pCG484 pCG188 مع م المنطقة من P1 إلى المنبع من P3 مع حذف نظير Rrs هذا العمل
pCG589 pCG212 مع م منطقة بها CS متحولة (C بدلاً من T) هذا العمل
البلازميدات المتماثلة
pCG246 بكتريا قولونية/ ناقلات المكوك العنقودية ، مشتق pCN47 مع قط كاسيت ( 50)
pCG599 pCG246 مع sae-gfp المنطقة من البلازميد pCG212 هذا العمل
pCG600 pCG246 مع sae-gfp المنطقة من البلازميد pCG484 هذا العمل
pCG601 pCG246 مع sae-gfp المنطقة من البلازميد pCG392 هذا العمل
pCG616 pCG246 مع sae-gfp المنطقة من البلازميد pCG589 هذا العمل
pCG618 pCG599 مع م المنطقة ذات الطفرة النقطية التي تؤثر على بنية Rrs الثانوية: CC في +3 و +8 بدلاً من AA ، و CC في +14 و +15 بدلاً من TT (يشار إلى الموضع على أنه مسافة إلى موقع الانقسام) هذا العمل
pCG620 pCG246 مع sae-gfp المنطقة من البلازميد pCG223 هذا العمل
للتكامل
pCG296 pCG246 مع rny للتكامل ( 11)
pCG322 pCG246 مع rny بدون موقع نشط للتكامل هذا العمل
pCG596 pCG246 مع rny تحمل الطفرات في الموقع النشط (H367A D368A) هذا العمل
لتنقية البروتين
pET15b ناقل التعبير البروتيني ، تحريض IPTG نوفاجين
pCG249 pET15b مع rny (بدون مجال الغشاء) هذا العمل

البناء البلازميد والانفعال

يتم سرد جميع البلازميدات والقليل النوكليوتيدات في الجدولين 1 و 2 على التوالي.

قليل النوكليوتيدات

غرض . نموذج . اسم . تسلسل .
سايب متحولة الحذف
ISP479C Kpnsae- مقابل كجججتاككاتاكتاكاجتتتاكات
Kpn-ORF4-rev ACCTCGGTACCCTGTTCTTACGACCTCTAAG
HybridORF4a-rechts تاآاجتكجكتاجاتاجججتكككجكجتاتجاتتكاكاجكك
Hybridsae- الروابط تككاتكتكجتتتكاتاككتكجاجكتاكتككتكاتتكتكتكاتت
نيومان 29 kanR مقابل CCGAGGTATGAAAACGAGAATTGG
kanR- مراجعة GGGACCCCTATCTAGCGAACTTT
sae – gfp الاندماج في البلازميد التكاملي (pCG188)
ايكو ساي فور GCGTGAATTCTTATTGTGCAAAAGGTTT
ايكو- sae1283rev كجتجاتكتجاكجتكجتاتجتجكاكا
ايكو- sae1014rev GGGAATTCTTATGTGAACAGGAAGTGTTT
التحكم في PCRs gfp- مراجعة جميع GGTATCACCTTCAAACTTGACTT
pCG213 PCwsae19 DelP2for TCAATATATACCATAAGATTGC
DelP2rev GCAATCTTATGGTATATATTGA
pCG218 PCwsae19 DelST-orf4for AGAGCACATAAGAAACACTTCCT
DelST-orf4rev AGGAAGTGTTTCTTATGTGCTCT
pCG219 PCwsae19 DelST5for TCAATGGAAAGCATATACAACT
DelST5rev AGTTGTATATATGCTTTCCATTGA
pCG223 PCwsae19 DelP2longfor TCAATGGAAAGCAAACACTTCCT
DelP2longrev AGGAAGTGTTGCTTTCCATTGA
pCG379 pCG218 DelST5rev AGTTGTATATATGCTTTCCATTGA
DelST5for TCAATGGAAAGCATATACAACT
pCG301 PCwsae19 الهجينة كتتككاتتجاجتااككتجاتكتجتجا
الهجينة CACAAGATCAAGGTACTCAATGGAAAGC
pCG392 PCwsae19 هجين تكاجكتكتاااااتتاجاتاااااااااتاتات
هجين أتاتاكاكتاتااتكتااتتتتاجكتاجات
pCG394 PCwsae19 هجين TGTGCTCTGCAATCTTATGATTGAAAAAAGGAAAGTATG
هجين كاتاكتككتكتتتتكاتككاتاجاتجكاجكاكا
pCG484 PCwsae19 الهجين- Rrs-Counter-rev كجاتتجتاجتجتاتجتجا
الهجين- Rrs-Counter-for تكاكاتاكاكتاكااتكجتتاتاتااتاكاكاكات
pCG589 pCG212 Q5SDMpCG212R أتاتتجاااااججااجتجاتجاتك
Q5SDMpCG212F ATACAACTATCAAATCCCATAAGATTG
sae – gfp الاندماج في البلازميد المتماثل (pCG246)
pCG599 pCG212 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتااتتاتاك
جيبسون-ساكونست-ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG600 pCG484 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتاتااتتاتاك
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG601 pCG392 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتاتااتتاتاك
جيبسون-ساكونست-ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG616 pCG589 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتاتااتتاتاك
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG618 pCG599 Q5SDMpCG618F AAGACCGCAGAGCACATAAGTAAATTTTTAG
Q5SDMpCG618R AGGGGAGTTAATAGTTGTATATATTGAAAAAGG
pCG620 pCG223 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتااتتاتاك
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
تكملة RNase Y
pCG322 RN6390 ريكا حفر مقابل جتكاججتاججاآاتجت
هجين- Rny-delKD-rev تجكاككتجاكجاجكتاكاتتتجاككجت
هجين- Rny-delKD- مقابل أكجتكاآاتجتاجكتكجتككاجتجكا
SAV1287- مراجعة AACAATTGTTGCAATTG
بامهي- RNY- مقابل CCGATCCGTTAAACTTAGCAAATATCCT
EcoRI-RNY-rev كجاتكككتاكاكتاجااتااتككتا
pCG596 pCG296 Q5SDMpCG296R جكتكجتتكجكتاتجتك
Q5SDMpCG296F تججاكتتاجكتجكتجتجتجتاجاككاتجاتك
العنصر
محول RNA 5΄ CTAGTACTCCGGTATTGCGGTACCCTTGTACGCCTGTTTTATA
gfp-rev1 تكتتتجتتجتكتجككات
سباق 2 السباق 2 GTATTGCGTACCCTTGT
gfp- مراجعة جميع GGTATCACCTTCAAACTTGACTT
تحقيقات DIG
gfppCG188 gfp-حفر مقابل كاكتجتكاكتكتتكجت
gfp- حفر-rev تكتكتكتتكجتجتجات
سايبRN6390 uorf4358 تاتاتتجككتكاتتتا
lorf4616 ACCTTTTGATGATTGTAGTAG
rnyRN6390 SAV1286dig مقابل TTATTAGAAGCAGGTGAACA
SAV1286dig-rev TCTTCAGGAGATACAATCACTC
صني 5 برايمRN6390 RNY- حفر مقابل 2 TTCATATAAAGAGCAAACCC
RNY- حفر- rev2 TTTTGATTGTCAGCTTCT
rnjARN6390 sav1089digfor كاككاتاككاكتاككات
sav1089digrev أككتجاغاتاككجتجت
RT-QPCR
معيار saeRرجل جديد T7sae تاتاكجاكتكاكتاتاججاجاجاكتجكاكااكاكاجا
saeR2 ككاتاتكجكتككتتكا
معيار saePرجل جديد T7-ORF4 TAATACGACTCACTATAGGAGACAAATTGAAGAAATGAGGAGTTA
lorf4616 ACCTTTTGATGATTGTAGTAG
saeR saeR4 تاغتكاتكككاكاكت
saeU4 ككاتتاكجككتاكتتا
سايب uorf4358 تاتاتتجككتكاتتتا
lorf4616 ACCTTTTGATGATTGTAGTAG
تنقية البروتين
pCG249 رجل جديد Xho-rny-pETfor GGGGCTCGAGCGAAATTGTTGCTTCAAAG
بام رني بيتريف GGGGGATCCTTATTTCGCATTCTACTGCT
نصوص RNase Y في المختبر فحص الانقسام
pCG212 و pCG484 T7saeorf4u TAATACGACTCACTATAGGAGACAAATTGAAGAAATGAGGAGTTA
LCgfpmut3.1rev1 تكتتتجتتجتكتجككات
غرض . نموذج . اسم . تسلسل .
سايب متحولة الحذف
ISP479C Kpnsae- مقابل كجججتاككاتاكتاكاجتتتاكات
Kpn-ORF4-rev ACCTCGGTACCCTGTTCTTACGACCTCTAAG
HybridORF4a-rechts تاآاجتكجكتاجاتاجججتكككجكجتاتجاتتكاكاجكك
Hybridsae- الروابط تككاتكتكجتتتكاتاككتكججاجكتاكتككتكاتتكتكتكاتت
نيومان 29 kanR مقابل CCGAGGTATGAAAACGAGAATTGG
kanR- مراجعة GGGACCCCTATCTAGCGAACTTT
sae – gfp الاندماج في البلازميد التكاملي (pCG188)
ايكو ساي فور GCGTGAATTCTTATTGTGCAAAAGGTTT
ايكو- sae1283rev كجتجاتكتجاكجتكجتاتجتجكاكا
ايكو- sae1014rev GGGAATTCTTATGTGAACAGGAAGTGTTT
التحكم في PCRs gfp- مراجعة جميع GGTATCACCTTCAAACTTGACTT
pCG213 PCwsae19 DelP2for TCAATATATACCATAAGATTGC
DelP2rev GCAATCTTATGGTATATATTGA
pCG218 PCwsae19 DelST-orf4for AGAGCACATAAGAAACACTTCCT
DelST-orf4rev AGGAAGTGTTTCTTATGTGCTCT
pCG219 PCwsae19 DelST5for TCAATGGAAAGCATATACAACT
DelST5rev AGTTGTATATATGCTTTCCATTGA
pCG223 PCwsae19 DelP2longfor TCAATGGAAAGCAAACACTTCCT
DelP2longrev AGGAAGTGTTGCTTTCCATTGA
pCG379 pCG218 DelST5rev AGTTGTATATATGCTTTCCATTGA
DelST5for TCAATGGAAAGCATATACAACT
pCG301 PCwsae19 الهجينة كتتككاتتجاجتااككتجاتكتجتجا
الهجينة CACAAGATCAAGGTACTCAATGGAAAGC
pCG392 PCwsae19 هجين تكاجكتكتااااااتتاجاتاااااااااتاتات
هجين أتاتاكاكتاتااتكتااتتتتاجكتاجات
pCG394 PCwsae19 هجين TGTGCTCTGCAATCTTATGATTGAAAAAAGGAAAGTATG
هجين كاتاكتككتكتتتتكاتككاتاجاتجكاجكاكا
pCG484 PCwsae19 الهجين- Rrs-Counter-rev كجاتتجتاجتجتاتجتجا
الهجين- Rrs-Counter-for تكاكاتاكاكتاكااتكجتتاتاتااتاكاكاكات
pCG589 pCG212 Q5SDMpCG212R أتاتتجاااااججااجتاتجاتك
Q5SDMpCG212F ATACAACTATCAAATCCCATAAGATTG
sae – gfp الاندماج في البلازميد المتماثل (pCG246)
pCG599 pCG212 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتاتااتتاتاك
جيبسون-ساكونست-ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG600 pCG484 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتاتااتتاتاك
جيبسون-ساكونست-ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG601 pCG392 جيبسون ساكونستانت فور ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGCAAAAGGTTTATAAATTTAATAC
جيبسون-ساكونست-ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG616 pCG589 جيبسون ساكونستانت فور ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGCAAAAGGTTTATAAATTTAATAC
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG618 pCG599 Q5SDMpCG618F AAGACCGCAGAGCACATAAGTAAATTTTTAG
Q5SDMpCG618R AGGGGAGTTAATAGTTGTATATATTGAAAAAGG
pCG620 pCG223 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتاتااتتاتاك
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
تكملة RNase Y
pCG322 RN6390 ريكا حفر مقابل جتكاججتاججاآاتجت
هجين- Rny-delKD-rev تجكاككتجاكجاجكتاكاتتتجاككجت
هجين- Rny-delKD- مقابل أكجتكاآاتجتاجكتكجتككاجتجكا
SAV1287- مراجعة AACAATTGTTGCAATTG
بامهي- RNY- مقابل CCGATCCGTTAAACTTAGCAAATATCCT
EcoRI-RNY-rev كغاتكككتاكاكتاجااتااتككتا
pCG596 pCG296 Q5SDMpCG296R جكتكجتتكجكتاتجتك
Q5SDMpCG296F تججاكتتاجكتجكتجتجتجتااجكااتجاتك
العنصر
محول RNA 5΄ CTAGTACTCCGGTATTGCGGTACCCTTGTACGCCTGTTTTATA
gfp-rev1 تكتتتجتتجتكتجككات
سباق 2 السباق 2 GTATTGCGTACCCTTGT
gfp- مراجعة جميع GGTATCACCTTCAAACTTGACTT
تحقيقات DIG
gfppCG188 gfp-حفر مقابل كاكتجتكاكتكتتكجت
gfp- حفر-rev تكتكتكتتكجتجتجات
سايبRN6390 uorf4358 تاتاتتجككتكاتتتا
lorf4616 ACCTTTTGATGATTGTAGTAG
rnyRN6390 SAV1286dig مقابل TTATTAGAAGCAGGTGAACA
SAV1286dig-rev TCTTCAGGAGATACAATCACTC
صني 5 برايمRN6390 RNY- حفر مقابل 2 TTCATATAAAGAGCAAACCC
RNY- حفر- rev2 تتجاتاتجتكاجكتكت
rnjARN6390 sav1089digfor كاككاتاككاكتاكات
sav1089digrev أككتجاغاتاككجتجت
RT-QPCR
معيار saeRرجل جديد T7sae تاتاكجاكتكاكتاتاججاجاجاكتجكاكااكاكاجا
saeR2 ككاتاتكجكتككتتكا
معيار saePرجل جديد T7-ORF4 TAATACGACTCACTATAGGAGAGACAAATTGAAGAAATGAGGAGTTA
lorf4616 ACCTTTTGATGATTGTAGTAG
saeR saeR4 تاغتكاتكككاكاكت
saeU4 ككاتتاكجككتاكتتا
سايب uorf4358 تاتاتتجككتكاتتتا
lorf4616 ACCTTTTGATGATTGTAGTAG
تنقية البروتين
pCG249 رجل جديد Xho-rny-pETfor GGGGCTCGAGCGAAATTGTTGCTTCAAAG
بام رني بيتريف GGGGGATCCTTATTTCGCATTCTACTGCT
نصوص RNase Y في المختبر فحص الانقسام
pCG212 و pCG484 T7saeorf4u TAATACGACTCACTATAGGAGAGACAAATTGAAGAAATGAGGAGTTA
LCgfpmut3.1rev1 تكتتتجتتجتكتجككات
غرض . نموذج . اسم . تسلسل .
سايب متحولة الحذف
ISP479C Kpnsae- مقابل CGGGGTACCATACTACAGTTTTACATT
Kpn-ORF4-rev ACCTCGGTACCCTGTTCTTACGACCTCTAAG
HybridORF4a-rechts تاآاجتكجكتاجاتاجججتكككجكجتاتجاتتكاكاجكك
Hybridsae- الروابط تككاتكتكجتتتكاتاككتكججاجكتاكتككتكاتتكتكتكاتت
نيومان 29 kanR مقابل CCGAGGTATGAAAACGAGAATTGG
kanR- مراجعة GGGACCCCTATCTAGCGAACTTT
sae – gfp الاندماج في البلازميد التكاملي (pCG188)
ايكو ساي فور GCGTGAATTCTTATTGTGCAAAAGGTTT
ايكو- sae1283rev كجتجاتكتجاكجتكجتاتجتجكاكا
ايكو- sae1014rev GGGAATTCTTATGTGAACAGGAAGTGTTT
التحكم في PCRs gfp- مراجعة جميع GGTATCACCTTCAAACTTGACTT
pCG213 PCwsae19 DelP2for TCAATATATACCATAAGATTGC
DelP2rev GCAATCTTATGGTATATATTGA
pCG218 PCwsae19 DelST-orf4for AGAGCACATAAGAAACACTTCCT
DelST-orf4rev AGGAAGTGTTTCTTATGTGCTCT
pCG219 PCwsae19 DelST5for TCAATGGAAAGCATATACAACT
DelST5rev AGTTGTATATATGCTTTCCATTGA
pCG223 PCwsae19 DelP2longfor TCAATGGAAAGCAAACACTTCCT
DelP2longrev AGGAAGTGTTGCTTTCCATTGA
pCG379 pCG218 DelST5rev AGTTGTATATATGCTTTCCATTGA
DelST5for TCAATGGAAAGCATATACAACT
pCG301 PCwsae19 الهجينة كتتككاتتجاجتااككتجاتكتجتجا
الهجينة CACAAGATCAAGGTACTCAATGGAAAGC
pCG392 PCwsae19 هجين تكاجكتكتاااااتتاجاتاااااااااتاتات
هجين أتاتاكاكتاتااتكتااتتتتاجكتاجات
pCG394 PCwsae19 هجين TGTGCTCTGCAATCTTATGATTGAAAAAAGGAAAGTATG
هجين كاتاكتككتكتتتتكاتككاتاجاتجكاجكاكا
pCG484 PCwsae19 الهجين- Rrs-Counter-rev كجاتتجتاجتجتاتجتجا
الهجين- Rrs-Counter-for تكاكاتاكاكتاكااتكجتتاتاتااتاكاكاكات
pCG589 pCG212 Q5SDMpCG212R أتاتتجاااااججااجتجاتجاتك
Q5SDMpCG212F ATACAACTATCAAATCCCATAAGATTG
sae – gfp الاندماج في البلازميد المتماثل (pCG246)
pCG599 pCG212 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتااتتاتاك
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG600 pCG484 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتااتتاتاك
جيبسون-ساكونست-ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG601 pCG392 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتاتااتتاتاك
جيبسون-ساكونست-ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG616 pCG589 جيبسون ساكونستانت فور ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGCAAAAGGTTTATAAATTTAATAC
جيبسون-ساكونست-ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG618 pCG599 Q5SDMpCG618F AAGACCGCAGAGCACATAAGTAAATTTTTAG
Q5SDMpCG618R AGGGGAGTTAATAGTTGTATATATTGAAAAAGG
pCG620 pCG223 جيبسون ساكونستانت فور أتاجاتاجكجكجككتجاتتكتاتجتجتجكآااججتتاتااتتاتاك
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
تكملة RNase Y
pCG322 RN6390 ريكا حفر مقابل جتكاججتاججاآاتجت
هجين- Rny-delKD-rev تجكاككتجاكجاجكتاكاتتتجاككجت
هجين- Rny-delKD- مقابل أكجتكاآاتجتاجكتكجتككاجتجكا
SAV1287- مراجعة AACAATTGTTGCAATTG
بامهي- RNY- مقابل CCGATCCGTTAAACTTAGCAAATATCCT
EcoRI-RNY-rev كغاتكككتاكاكتاجااتااتككتا
pCG596 pCG296 Q5SDMpCG296R جكتكجتتكجكتاتجتك
Q5SDMpCG296F تججاكتتاجكتجكتجتجتجتااجكااتجاتك
العنصر
محول RNA 5΄ CTAGTACTCCGGTATTGCGGTACCCTTGTACGCCTGTTTTATA
gfp-rev1 تكتتتجتتجتكتجككات
سباق 2 السباق 2 GTATTGCGTACCCTTGT
gfp- مراجعة جميع GGTATCACCTTCAAACTTGACTT
تحقيقات DIG
gfppCG188 gfp-حفر مقابل كاكتجتكاكتكتتكجت
gfp- حفر-rev تكتكتكتتكجتجتجات
سايبRN6390 uorf4358 تاتاتتجككتكاتتتا
lorf4616 ACCTTTTGATGATTGTAGTAG
rnyRN6390 SAV1286dig مقابل TTATTAGAAGCAGGTGAACA
SAV1286dig-rev TCTTCAGGAGATACAATCACTC
صني 5 برايمRN6390 RNY- حفر مقابل 2 TTCATATAAAGAGCAAACCC
RNY- حفر- rev2 TTTTGATTGTCAGCTTCT
rnjARN6390 sav1089digfor كاككاتاككاكتاككات
sav1089digrev أككتجاغاتاككجتجت
RT-QPCR
معيار saeRرجل جديد T7sae تاتاكجاكتكاكتاتاججاجاجاكتجكاكااكاكاجا
saeR2 ككاتاتكجكتككتتكا
معيار saePرجل جديد T7-ORF4 TAATACGACTCACTATAGGAGAGACAAATTGAAGAAATGAGGAGTTA
lorf4616 ACCTTTTGATGATTGTAGTAG
saeR saeR4 تاغتكاتكككاكاكت
saeU4 ككاتتاكجككتاكتتا
سايب uorf4358 تاتاتتجككتكاتتتا
lorf4616 ACCTTTTGATGATTGTAGTAG
تنقية البروتين
pCG249 رجل جديد Xho-rny-pETfor GGGGCTCGAGCGAAATTGTTGCTTCAAAG
بام رني بيتريف GGGGGATCCTTATTTCGCATTCTACTGCT
نصوص RNase Y في المختبر فحص الانقسام
pCG212 و pCG484 T7saeorf4u TAATACGACTCACTATAGGAGACAAATTGAAGAAATGAGGAGTTA
LCgfpmut3.1rev1 تكتتتجتتجتكتجككات
غرض . نموذج . اسم . تسلسل .
سايب متحولة الحذف
ISP479C Kpnsae- مقابل كجججتاككاتاكتاكاجتتتاكات
Kpn-ORF4-rev ACCTCGGTACCCTGTTCTTACGACCTCTAAG
HybridORF4a-rechts تاآاجتكجكتاجاتاجججتكككجكجتاتجاتتكاكاجكك
Hybridsae- الروابط تككاتكتكجتتتكاتاككتكججاجكتاكتككتكاتتكتكتكاتت
نيومان 29 kanR مقابل CCGAGGTATGAAAACGAGAATTGG
kanR- مراجعة GGGACCCCTATCTAGCGAACTTT
sae – gfp الاندماج في البلازميد التكاملي (pCG188)
ايكو ساي فور GCGTGAATTCTTATTGTGCAAAAGGTTT
ايكو- sae1283rev كجتجاتكتجاكجتكجتاتجتجكاكا
ايكو- sae1014rev GGGAATTCTTATGTGAACAGGAAGTGTTT
التحكم في PCRs gfp- مراجعة جميع GGTATCACCTTCAAACTTGACTT
pCG213 PCwsae19 DelP2for TCAATATATACCATAAGATTGC
DelP2rev GCAATCTTATGGTATATATTGA
pCG218 PCwsae19 DelST-orf4for AGAGCACATAAGAAACACTTCCT
DelST-orf4rev AGGAAGTGTTTCTTATGTGCTCT
pCG219 PCwsae19 DelST5for TCAATGGAAAGCATATACAACT
DelST5rev AGTTGTATATATGCTTTCCATTGA
pCG223 PCwsae19 DelP2longfor TCAATGGAAAGCAAACACTTCCT
DelP2longrev AGGAAGTGTTGCTTTCCATTGA
pCG379 pCG218 DelST5rev AGTTGTATATATGCTTTCCATTGA
DelST5for TCAATGGAAAGCATATACAACT
pCG301 PCwsae19 الهجينة كتتككاتتجاجتااككتجاتكتجتجا
الهجينة CACAAGATCAAGGTACTCAATGGAAAGC
pCG392 PCwsae19 هجين تكاجكتكتااااااتتاجاتاااااااااتاتات
هجين أتاتاكاكتاتااتكتااتتتتاجكتاجات
pCG394 PCwsae19 هجين TGTGCTCTGCAATCTTATGATTGAAAAAAGGAAAGTATG
هجين كاتاكتككتكتتتتكاتككاتاجاتجكاجكاكا
pCG484 PCwsae19 الهجين- Rrs-Counter-rev كجاتتجتاجتجتاتجتجا
الهجين- Rrs-Counter-for تكاكاتاكاكتاكااتكجتتاتاتااتاكاكاكات
pCG589 pCG212 Q5SDMpCG212R أتاتتجاااااججااجتاتجاتك
Q5SDMpCG212F ATACAACTATCAAATCCCATAAGATTG
sae – gfp الاندماج في البلازميد المتماثل (pCG246)
pCG599 pCG212 جيبسون ساكونستانت فور ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGCAAAAGGTTTATAAATTTAATAC
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG600 pCG484 جيبسون ساكونستانت فور ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGCAAAAGGTTTATAAATTTAATAC
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG601 pCG392 جيبسون ساكونستانت فور ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGCAAAAGGTTTATAAATTTAATAC
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG616 pCG589 جيبسون ساكونستانت فور ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGCAAAAGGTTTATAAATTTAATAC
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
pCG618 pCG599 Q5SDMpCG618F AAGACCGCAGAGCACATAAGTAAATTTTTAG
Q5SDMpCG618R AGGGGAGTTAATAGTTGTATATATTGAAAAAGG
pCG620 pCG223 جيبسون ساكونستانت فور ATTTAGAATAGGCGCGCCTGAATTCTTATTGTGCAAAAGGTTTATAAATTTAATAC
جيبسون سايكسترن ريف أتككككججتاككجاجكتكجاتكتكتاكااكااااجكجاتاك
تكملة RNase Y
pCG322 RN6390 ريكا حفر مقابل جتكاججتاججاآاتجت
هجين- Rny-delKD-rev تجكاككتجاكجاجكتاكاتتتجاككجت
هجين- Rny-delKD- مقابل أكجتكاآاتجتاجكتكجتككاجتجكا
SAV1287- مراجعة AACAATTGTTGCAATTG
بامهي- RNY- مقابل CCGATCCGTTAAACTTAGCAAATATCCT
EcoRI-RNY-rev كغاتكككتاكاكتاجااتااتككتا
pCG596 pCG296 Q5SDMpCG296R جكتكجتتكجكتاتجتك
Q5SDMpCG296F تججاكتتاجكتجكتجتجتجتااجكااتجاتك
العنصر
محول RNA 5΄ CTAGTACTCCGGTATTGCGGTACCCTTGTACGCCTGTTTTATA
gfp-rev1 تكتتتجتتجتكتجككات
سباق 2 السباق 2 GTATTGCGTACCCTTGT
gfp- مراجعة جميع GGTATCACCTTCAAACTTGACTT
تحقيقات DIG
gfppCG188 gfp-حفر مقابل كاكتجتكاكتكتتكجت
gfp- حفر-rev تكتكتكتتكجتجتجات
سايبRN6390 uorf4358 تاتاتتجككتكاتتتا
lorf4616 ACCTTTTGATGATTGTAGTAG
rnyRN6390 SAV1286dig مقابل TTATTAGAAGCAGGTGAACA
SAV1286dig-rev TCTTCAGGAGATACAATCACTC
صني 5 برايمRN6390 RNY- حفر مقابل 2 TTCATATAAAGAGCAAACCC
RNY- حفر- rev2 TTTTGATTGTCAGCTTCT
rnjARN6390 sav1089digfor كاككاتاككاكتاككات
sav1089digrev أككتجاغاتاككجتجت
RT-QPCR
معيار saeRرجل جديد T7sae تاتاكجاكتكاكتاتاججاجاجاكتجكاكااكاكاجا
saeR2 ككاتاتكجكتككتتكا
معيار saePرجل جديد T7-ORF4 TAATACGACTCACTATAGGAGACAAATTGAAGAAATGAGGAGTTA
lorf4616 ACCTTTTGATGATTGTAGTAG
saeR saeR4 تاغتكاتكككاكاكت
saeU4 ككاتتاكجككتاكتتا
سايب uorf4358 تاتاتتجككتكاتتتا
lorf4616 ACCTTTTGATGATTGTAGTAG
تنقية البروتين
pCG249 رجل جديد Xho-rny-pETfor GGGGCTCGAGCGAAATTGTTGCTTCAAAG
بام رني بيتريف GGGGGATCCTTATTTCGCATTCTACTGCT
نصوص RNase Y في المختبر فحص الانقسام
pCG212 و pCG484 T7saeorf4u TAATACGACTCACTATAGGAGACAAATTGAAGAAATGAGGAGTTA
LCgfpmut3.1rev1 تكتتتجتتجتكتجككات

متحولة حذف saeP و saeP rny double mutant

استبدال سايب موضع مع كاسيت مقاومة كاناميسين (كان) عن طريق تفاعل البلمرة المتسلسل (PCR). تم هضم amplicon الناتج باستخدام KpnI واستنساخه في pBT2 (32). للاستفادة من الاختيار الأزرق والأبيض ، تم بعد ذلك استنساخ شظايا الاندماج في مواقع EcoRI و SalI في pMAD (33). تم التحقق من البلازميد الناتج ، pCWSAE30 ، وتحويله إلى سلالة RN4220 التي تعاني من نقص التقييد ، متبوعة بطفرات كما هو موضح سابقًا (33). تم التحقق من المتحولة (المشار إليها باسم RN4220-30) بواسطة PCR والرحلان الكهربي للهلام النبضي. تم نقل الطفرة الناتجة إلى نيومان ، مما أسفر عن سلالة نيومان -30. ال سايب رني تم الحصول على متحولة مزدوجة (يشار إليها باسم Newman-217-30) عن طريق تحويل rny :: ermC طفرة من RN4220-217 (11) إلى نيومان -30.

بناء انصهار sae-gfp

تم تحقيق بناء البلازميدات التكاملية باستخدام pCG188 (11) ، والذي يسمح بتكامل البلازميد في جي المكان. عمليات الحذف المختلفة في ملف م تم إدخال المنطقة الممتدة من المروج P1 حتى المنبع للمروج P3 عن طريق تداخل PCR باستخدام قليل النيوكليوتيدات والقوالب المدرجة في الجدول 2. تم ربط الأمبليكون في pCG188 المهضوم من EcoRI لتوليد البلازميدات المختلفة المدرجة في الجدول 1. الاتجاه الصحيح والتسلسل الصحيح تم التحقق من الإدخالات بواسطة PCR باستخدام قليل النوكليوتيد المنبع مع gfp-rev-all ، وعن طريق تسلسل Sanger قبل الاندماج في جين الليباز المختص بكتريا المكورة العنقودية البرتقالية CYL316 (34). تم بعد ذلك تحويل البلازميدات المتكاملة إلى التجربة المناسبة بكتريا المكورة العنقودية البرتقالية سلالات. تم التحقق من جميع المحولات بواسطة PCR. لاستنساخ بنيات sae-gfp في pCG246 البلازميد التكراري ، فإن sae-gfp تم استنساخ المنطقة من البلازميدات pCG212 و pCG392 و pCG484 و pCG223 بواسطة تجميع Gibson باستخدام قليلات النوكليوتيدات المدرجة في الجدول 2 لتوليد pCG599 و pCG600 و pCG601 و pCG620 على التوالي. تم التحقق من البلازميدات عن طريق تسلسل Sanger ، واستنسخت في DC10B ثم نقلت إلى كفاءة كهربائية بكتريا المكورة العنقودية البرتقالية سلالات.

بناء بناء sae-gfp مع CS متحور أو هيكل ثانوي متحور

تم إدخال الطفرات النقطية في التركيبات الانتقائية عن طريق الطفرات الموجهة بالموقع (SDM Q5 Kit ، New England Biolabs) وفقًا لتعليمات الشركة المصنعة باستخدام قليلات النوكليوتيدات المدرجة في الجدول 2. طفرة CS (C / T) في م تم إدخال موقع الانقسام في البلازميد pCG212 لتوليد البلازميد pCG589. ال sae-gfp تم بعد ذلك استنساخ المنطقة في البلازميد pCG589 في البلازميد التكراري pCG246 بواسطة مجموعة جيبسون باستخدام قليلات النوكليوتيدات المدرجة في الجدول 2 لتوليد pCG616. تم إدخال طفرات النقطة لمنع تكوين البنية الثانوية في اتجاه مجرى CS (الشكل 6C) مباشرة في البلازميد pCG599 لتوليد البلازميدات pCG618. تم التحقق من جميع البلازميدات عن طريق تسلسل Sanger ، وتم استنساخها في DC10B ونقلها إلى كفاءة كهربائية بكتريا المكورة العنقودية البرتقالية سلالات.

بناء سلالات مكملة بـ RNase Y مع حذف أو طفرات (H367A ، D368A) في موقعها النشط

تم تقديم حذف 300 نقطة أساس في موقع RNase Y النشط عن طريق تداخل PCR باستخدام أليغنوكليوتيدات المدرجة في الجدول 2. تم استنساخ amplicon في BamHI / EcoRI-Digested pCG246 لتوليد pCG322 البلازميد. تم إدخال طفرات H367A و D368A في الموقع النشط RNase Y في البلازميد pCG296 عن طريق الطفرات الموجهة للموقع (SDM Q5 Kit) وفقًا لتعليمات الشركة المصنعة (New England Biolabs) لتوليد البلازميد pCG596. تم استنساخ كلا البلازميدات في بكتريا قولونية DC10B ثم قدم إلى نيومان rny متحولة.

عزل الحمض النووي الريبي ، تهجين اللطخة الشمالية والكمي RT-qPCR

تم إجراء عزل الحمض النووي الريبي وتحليل اللطخة الشمالية كما هو موضح سابقًا (35). باختصار ، تم تحلل البكتيريا في 1 مل من كاشف TRIzol (Invitrogen) مع 0.5 مل من خرزات الزركونيا والسيليكا (قطر 0.1 مم) في الخالط عالي السرعة. ثم تم عزل الحمض النووي الريبي كما هو موصوف من قبل الشركة المصنعة. لتحليل اللطخة الشمالية ، تم إنشاء تحقيقات DNA الموصوفة بالديجوكسيجينين (DIG) للكشف عن النصوص المحددة باستخدام مجموعة PCR التي تحمل علامات DIG كما هو موضح من قبل الشركة المصنعة (Roche Life Science) مع قليل النوكليوتيدات المدرجة في الجدول 2.

وفرة نص saeR و سايب من ثلاث تجارب مستقلة تم تحديدها بواسطة RT-qPCR في الوقت الفعلي (تشغيل في نسختين) كما هو موضح سابقًا (36). باختصار ، تمت معالجة 5 ميكروغرام من كل عينة RNA باستخدام DNaseI لمدة 30 دقيقة عند درجة حرارة الغرفة ، وتم إيقاف التفاعل باستخدام كاشف تعطيل DNase (Invitrogen). تم بعد ذلك تخفيف الحمض النووي الريبي 1:10 ، وتم إجراء qRT-PCR بخطوة واحدة باستخدام مجموعة التضخيم لـ SYBR Green (Roche Life Science) باستخدام قليلات النوكليوتيدات المناسبة المدرجة في الجدول 2.

للتقدير الكمي ، نصوص الحمض النووي الريبي الخاصة بالتسلسل saeR و سايب تم تحضيرها كما هو موضح سابقًا (36). باختصار ، تم استخدام الاشعال الخاص بالجينات بامتداد 5 ، بما في ذلك تسلسل مروج T7 (الجدول 2) ، من أجل PCR القياسي. يحركها T7 في المختبر تم إجراء النسخ باستخدام اختبار النسخ القياسي (T7-MEGAshortscript Invitrogen). بعد علاج DNase I ، تم استرداد الحمض النووي الريبي باستخدام مجموعة MEGAclear Kit (Invitrogen) ، وتم إجراء القياس الكمي للحمض النووي الريبي بطريقة القياس الطيفي. تم التحقق من نقاء المواد الهلامية التي تحتوي على مادة الاغاروز ونسبة A260 / 280. تم إنشاء المنحنيات القياسية لمعايير RNA الخاصة بالتسلسل عن طريق التخفيف التسلسلي (1 × 10 6 ، 3.16 × 10 5 ، 1 × 10 5 ، 3.16 × 10 4 ، 1 × 10 4 ، 3.16 × 10 3 و 1 × 10 3) ، وتم حساب أرقام نسخ نصوص العينات بمساعدة برنامج light cycler 480 (التقدير الكمي المطلق / المشتق الثاني بحد أقصى ، Roche Life Science). تضخيم سايب و saeR بكفاءة 1.85 و 1.89 وخطأ 0.012 و 0.011 على التوالي.

5΄ ينتهي التضخيم السريع لـ (كدنا)

5 ΄ تم إجراء التضخيم السريع لنهايات (كدنا) (RACE) كما هو موضح سابقًا (11). باختصار ، تم عزل الحمض النووي الريبي الكلي وإزالة الرنا الريباسي باستخدام MICROBExpress (Invitrogen). ثم تم ربط محول RNA 5΄ محدد (الجدول 2) بـ RNA. بعد استخراج الفينول / الكلوروفورم وترسيب الإيثانول ، تعرض الحمض النووي الريبي للنسخ العكسي باستخدام قليل النوكليوتيد gfp-rev1. تم إجراء PCR المتداخل باستخدام oligonucleotides Race 2 و gfp-rev-all (الجدول 2). تم الكشف عن أمبليكون PCR على 3 ٪ من هلام الاغاروز ، تمت التصفية التتابعية ، المستنسخة في pCRII-TOPO (Invitrogen) وتسلسلها.

تنقية البروتين و في المختبر فحص

تنقية البروتين

لإنشاء البلازميد للإفراط في إنتاج RNase Y مع N-terminal His-Tag ، تسلسل الترميز لـ rny تم تضخيم الجين باستثناء أول 24 وحدة بنائية تشتمل على مجال غشاء مفترض باستخدام PCR باستخدام الاشعال المدرجة في الجدول 2. تم ربط amplicon في ناقل pET-11b XhoI / BamHI-Digested (Novagen) ، مما أدى إلى pCG249. بكتريا قولونية تمت زراعة BL21 (DE3) المحول باستخدام pCG249 أو باستخدام بلازميد فارغ (كعنصر تحكم) في مرق Luria-Bertani الذي يحتوي على 100 ميكروغرام مل من أمبيسيلين و 25 ميكروغرام مل كلورامفينيكول عند 37 درجة مئوية إلى OD 600 من 0.5. تم إحداث تعبير البروتين في كل من سلالات BL21 (للتعبير عن RNase Y والتحكم الفارغ) باستخدام 1 ملي مولار من IPTG لمدة ساعتين. تم حصاد الخلايا البكتيرية بالطرد المركزي وتعليقها في محلول تحلل (100 ملي مولار الصوديوم2ص4، 10 مم تريس ، 8 م إريا و 10 مم إيميدازول درجة الحموضة 8). تمت إضافة كوكتيل مثبط البروتياز الخالي من EDTA (Roche Life Science) والليزوزيم (1 مجم مل -1) وتم رج الخليط عند درجة حرارة الغرفة لمدة 30 دقيقة. تم تحقيق التحلل الكامل عن طريق الصوتنة. تم طرد المجانسة الناتجة عند 10000 × ز لمدة 30 دقيقة لتكوير الحطام الخلوي. تمت إضافة ما مجموعه 1 مل من ملاط ​​Ni-NTA بنسبة 50٪ (Quiagen) إلى 4 مل من المحللة وخلطها برفق عن طريق الرج لمدة 60 دقيقة. تم بعد ذلك إجراء تنقية العمود باتباع إرشادات الشركة المصنعة (Quiagen). تم تحليل الكسور المستخرجة بواسطة دوديسيل كبريتات الصوديوم - بولي أكريلاميد هلام الكهربائي للتحقق من النقاء. تم جمع الأجزاء المحتوية على البروتين المؤتلف ودالتها مقابل HEPES 20 ملي مولار ، كلوريد الصوديوم 100 ملي مولار ، الجلسرين 30٪ ، MgCl2 1 مم والصوديوم deoxycholate 0.2٪ لمدة 24 ساعة عند 4 درجات مئوية. تم تنفيذ إجراء التنقية بالتوازي باستخدام BL21 مع pET-11b واستخدم كعنصر تحكم في فحوصات النشاط.

النشاط الأنزيمي

لمراقبة النشاط الأنزيمي ، تم استخدام اختبار لنشاط الفوسفوديستيراز مقابل 1 ملي مولار ثنائي pNpp (Roche Life Science) ، كما هو موضح سابقًا (27). تمت إضافة RNase Y المؤتلف إلى HEPES 20 ملي مولار وكلوريد الصوديوم 100 ملي مولار عند الرقم الهيدروجيني 8 الذي يحتوي على 1 ملي MnCl2. الركيزة الكروموجينية bis-pNPP (ص-فوسفات نيتروفينيل) عند 1 ملي مولار. تم إجراء التفاعلات في حجم 100 ميكرولتر في 96 طبق ميكروتيتر جيدًا عند 37 درجة مئوية. تمت مراقبة التحلل المائي لـ bis-pNPP بقياس الزيادة في الامتصاصية عند 405 نانومتر بمساعدة قارئ Infinite 200 ProSeries (Tecan).

مقايسة انشقاق RNase Y

تم تحضير نصوص RNA الخاصة بالتسلسل للبنيات pCG212 و pCG484 بواسطة في المختبر النسخ باستخدام الاشعال المدرجة في الجدول 2. يحركها T7 في المختبر تم إجراء النسخ في اختبار النسخ القياسي (T7-MEGAshortscript). بعد علاج DNase I ، تم استرداد الحمض النووي الريبي باستخدام مجموعة MEGAclear Kit (Invitrogen) ، وتم إجراء القياس الكمي للحمض النووي الريبي بطريقة القياس الطيفي. تم إجراء مقايسة انشقاق RNase Y باستخدام 0.125 ميكروغرام من ركيزة RNA وتنقيتها 1.36 ميكرومتر من RNase Y أو سائل التحكم في خلايا Bl21 ، pET-11b في حجم تفاعل 10 ميكرولتر (20 ملي HEPES درجة الحموضة 8 ، 100 ملي كلوريد الصوديوم ، 1 ملي MnCl2 أو 8 ملي MgCl2). تم تحضين التفاعلات لمدة 10 دقائق عند 30 درجة مئوية. بعد ترسيب الإيثانول ، تم إذابة الحمض النووي الريبي في محلول تحميل 10 ميكرولتر (50 ٪ فورماميد ، 6.5 ٪ فورمالديهايد ، 3 ميكروغرام بروميد إيثيديوم ، في محلول حمض بروبان سلفونيك 40 ملي مولار 3 (N-morpholino)) وتم تحميل الحمض النووي الريبي على هلام الاغاروز الذي يفسد التشبع (1 ٪) الاغاروز ، 1.8٪ فورمالدهايد في 40 ملي مولار 3- (N-morpholino) عازلة حمض البروبان سلفونيك). تم الكشف عن النصوص عن طريق تحليل اللطخة الشمالية باستخدام gfp تم إنشاء مجسات DIG كما هو موضح أعلاه.


طريقة بسيطة وفعالة لاستخراج بوليميراز DNA Taq

بوليميراز DNA القابل للحرارة (Taq Pol) من Thermus aquaticus تم استخدامه على نطاق واسع في تفاعل البوليميراز المتسلسل ، والذي عادة ما يتم استخراجه بطريقة Pluthero & # x27s. استخدمت الطريقة كبريتات الأمونيوم لترسيب الإنزيم ، ووفرت الجهد والمال ولكن ليس الوقت. علاوة على ذلك ، وجدنا أن 30-40 ٪ من نشاط Taq Pol I فقد في خطوة ترسيب كبريتات الأمونيوم ، وكان المنتج يحتوي على كمية صغيرة من الحمض النووي.

نتائج

قدمنا ​​طريقة جديدة ومبسطة ومنخفضة التكلفة لتنقية Taq Pol بعد الإفراط في إنتاج الإنزيم في الإشريكية القولونية، والتي تستخدم الإيثانول بدلاً من كبريتات الأمونيوم لترسيب الإنزيم. يمكن إذابة الراسب مباشرة في المخزن المؤقت بدون غسيل الكلى. بالإضافة إلى ذلك ، تمت إزالة تلوث الحمض النووي والحمض النووي الريبي باستخدام DNase I و RNase A قبل الترسيب ، وتم تحسين إجراء الاستخراج. تزيد التحسينات التي أجريناها من معدل الاسترداد والنشاط المحدد للإنزيم ، وتوفر العمالة والوقت والتكلفة.

الاستنتاجات

تستخدم طريقتنا الإيثانول ، و DNase I ، و RNase A لتنقية Taq Pol ، وتبسيط العملية ، وزيادة معدل استرداد الإنزيم وجودته.


قضية RNase و EtOH - علم الأحياء

ماري آن إيمانويل ، دكتوراه في الطب ، هي أستاذة في قسم الطب ، قسم الكيمياء الحيوية الجزيئية والخلوية ، وقسم البحث عن تعاطي المخدرات ، كلية ستريتش للطب بجامعة لويولا ، مايوود ، إلينوي.

نيكولاس ف. إيمانويل ، دكتور في الطب ، هو أستاذ في قسم الطب ، قسم الأبحاث حول إساءة استخدام العقاقير ، كلية الطب بجامعة لويولا ، مايوود ، إلينوي ، وطبيب في مستشفى شؤون المحاربين القدامى ، هاينز ، إلينوي.

يؤثر تعاطي الكحول على الأجزاء الثلاثة من محور الوطاء - الغدة النخامية - الغدد التناسلية (HPG) ، وهو نظام من الغدد الصماء والهرمونات التي تشارك في التكاثر الذكري. يرتبط تعاطي الكحول بانخفاض هرمون التستوستيرون ومستويات متغيرة من الهرمونات التناسلية الإضافية. يدرس الباحثون عدة آليات محتملة لتلف الكحول. ترتبط هذه الآليات بعملية التمثيل الغذائي للكحول ، وتلف الخلايا المرتبط بالكحول ، والتفاعلات الهرمونية الأخرى المرتبطة باستهلاك الكحول. كما تبين أن استخدام الكحول المزمن في ذكور الجرذان يؤثر على قدرتها الإنجابية وصحة نسلها. الكلمات المفتاحية: التأثيرات التناسلية لمحور الغدة النخامية - الغدة النخامية - التناسلية لـ AODU (تعاطي الكحول والمخدرات الأخرى) خصيتي الجهاز التناسلي الذكري أكسدة أكسيد النيتريك ، التمثيل الغذائي للإيثانول إلى الأسيتالديهيد ، موت الخلايا المبرمج ، إفراز الهرمون اللوتيني ، المواد الأفيونية للخصوبة

يعتبر جهاز الغدد الصماء ، الذي يتكون من عدة أعضاء منتجة للهرمونات في جميع أنحاء الجسم ، جزءًا لا يتجزأ من جميع وظائف الجسم الطبيعية ، بما في ذلك النمو والتطور والتمثيل الغذائي والتكاثر. تستعرض هذه المقالة الأبحاث حول تأثير تعاطي الكحول على جزء من نظام الغدد الصماء المتورط في تكاثر الذكور ، وهو محور الوطاء - الغدة النخامية - الغدد التناسلية (HPG). يشتمل هذا النظام المكون من الغدد الصماء والهرمونات على منطقة دماغية تسمى ما تحت المهاد والغدة النخامية ، وتقع في قاعدة الدماغ والغدد التناسلية الذكرية (الخصيتين). يسلط المقال أيضًا الضوء على استراتيجيات جديدة واعدة لمنع أو عكس الآثار الضارة للكحول على الجهاز التناسلي الذكري ويصف البحث الذي يبحث في الآليات الجزيئية التي يعمل الكحول من خلالها على هذا النظام.

نظرة عامة على الجهاز التناسلي للذكور

من بين المكونات الثلاثة لمحور HPG ، فإن منطقة ما تحت المهاد والغدة النخامية لها وظائف تنظيمية فقط ، والتي تتوسط فيها الهرمونات التي تنتجها وتفرزها ، كما هو موضح في الفقرة التالية. ينتج المكون الثالث - الخصيتان - أيضًا هرمونات رئيسية ، بما في ذلك هرمون التستوستيرون ، الذي يتحكم في الخصائص والسلوكيات الجنسية للذكور. بالإضافة إلى ذلك ، فإن الخصيتين مسؤولتان عن إنتاج الحيوانات المنوية.

ينتج الوطاء هرمون إفراز الهرمون اللوتيني (LHRH) ، والذي يتم إطلاقه على شكل نبضات في نظام الأوعية الدموية التي تربط الوطاء والغدة النخامية. استجابةً لإشارة LHRH ، تنتج الغدة النخامية هرمونين بروتينيين يُطلق عليهما gonadotropins. يتم إطلاق هذين الهرمونين - الهرمون اللوتيني (LH) والهرمون المنبه للجريب (FSH) - في الدورة الدموية العامة للجسم ويعملان بشكل أساسي على مستوى الغدد التناسلية. في الذكور ، يحفز LH إنتاج هرمون التستوستيرون من خلايا متخصصة تسمى خلايا Leydig. FSH مهم لنضج الحيوانات المنوية في جزء آخر من الخصيتين ، البربخ. يدور التستوستيرون في الدم عائدًا إلى وحدة الغدة النخامية - الغدة النخامية وينظم إنتاج وإفراز LHRH و LH (انظر الشكل 1). عندما يعمل النظام بشكل طبيعي ، يؤدي انخفاض مستوى هرمون التستوستيرون إلى ارتفاع في هرمونات الغدد التناسلية النخامية. البرولاكتين ، وهو هرمون تناسلي ثالث يتم تصنيعه في الغدة النخامية ، مهم لتخليق وإفراز LHRH الطبيعي.

شكل 1 محور الوطاء - الغدة النخامية - الغدد التناسلية. ينتج الوطاء الهرمون المطلق للهرمون الملوتن (LHRH) ، والذي يتم إطلاقه في الغدة النخامية. استجابة لإشارة LHRH ، تنتج الغدة النخامية الهرمون الملوتن (LH) والهرمون المنبه للجريب (FSH). عند الذكور ، يحفز هرمون LH إنتاج هرمون التستوستيرون ويعتبر FSH مهمًا لنضج الحيوانات المنوية. يدور التستوستيرون في الدم عائدًا إلى وحدة الغدة النخامية - الغدة النخامية وينظم إنتاج وإفراز LHRH و LH.

ملاحظة: + = تأثير تحفيزي - = تأثير مثبط.

ارتبطت المستويات المنخفضة من هرمون التستوستيرون (أي قصور الغدد التناسلية) لدى الرجال البالغين بمجموعة متنوعة من المشكلات الطبية بما في ذلك هشاشة العظام المتسارعة ، وانخفاض وظيفة العضلات والبروستاتا ، وفقر الدم ، وتغير وظيفة المناعة ، وانخفاض القدرة على الإنجاب (Klein and Duwall 1994 Jackson and Klerekoper 1990 Azad et al. 1991 Berczi et al. 1981 هادلي 1988). كل من هذه الحالات يمكن أن تسبب مشاكل صحية كبيرة. تكون تأثيرات انخفاض هرمون التستوستيرون هذه أكبر لدى الرجال البالغين الذين لديهم مستويات منخفضة من هرمون التستوستيرون منذ فترة المراهقة مقارنةً بالرجال البالغين الذين يعانون من انخفاض مستويات هرمون التستوستيرون فقط في مرحلة البلوغ (Hadley 1988 Yen and Jaffe 1991). المراهق أو المراهق الذي يعاني من انخفاض قصير المدى ومتقطع في هرمون التستوستيرون أو قصور الغدد التناسلية الدائم يكون عرضة لتجربة هذه المشاكل لاحقًا في الحياة.

أثبتت الأبحاث التي أجريت على الحيوانات بشكل ثابت وجود ارتباط بين استهلاك الكحول الحاد (مرة واحدة ، مرة واحدة) والمزمن (أي على المدى الطويل) وبين انخفاض هرمون التستوستيرون. مع انخفاض مستويات هرمون التستوستيرون ، من المتوقع أن تزداد مستويات LH و FSH لتحفيز إنتاج المزيد من هرمون التستوستيرون. ومع ذلك ، تشير الدراسات التي أجريت على ذكور الفئران الصغيرة (أي البلوغ) إلى أن التعرض الحاد والمزمن للكحول يؤدي إلى تثبيط عميق لهرمون التستوستيرون مصحوبًا بمستويات منخفضة أو طبيعية من LH و FSH ، عند توقع مستويات مرتفعة (Hadley 1988 Yen and Jaffe 1991). يشير هذا إلى أن الخلايا تحت المهاد التي تنتج LHRH لا تعمل بشكل صحيح عند إزالة التغذية المرتدة التي يقدمها هرمون التستوستيرون (أي عندما تنخفض مستويات هرمون التستوستيرون). وهكذا يبدو أن التأثيرات الضارة للكحول على التكاثر تتم على جميع المستويات الثلاثة للوحدة التناسلية الذكرية: الوطاء ، والغدة النخامية ، والخصيتين.

الكحول والاختبارات

تم إجراء معظم الدراسات حول تأثيرات الكحول على تكاثر الذكور في الفئران لأن نموذج الفئران يحاكي الجهاز التناسلي الذكري البشري. أظهرت الأبحاث أن كلاً من التعرض الحاد والمزمن للكحول مرتبط بمستويات منخفضة من هرمون LHRH تحت المهاد والغدة النخامية في البالغين (Cicero 1982 Salonen et al. 1992) والفئران الذكور البلوغية ، وقد اقترحت دراسات أخرى أن الكحول يثبط إفراز هرمون التستوستيرون بواسطة الخصيتين كذلك (ليتل وآخرون 1992). على سبيل المثال ، فحصت العديد من الدراسات تأثيرات الكحول على تخليق هرمون التستوستيرون ، والذي يحدث عبر مسار التستوستيرون التخليقي الحيوي. يتكون هذا المسار من سلسلة من سلائف الستيرويد لهرمون التستوستيرون والإنزيمات المعنية اللازمة لتجميع كل سلائف من السابقة (هادلي 1988) (انظر الشكل 2). لعدة أسباب تتعلق بالاختلافات في التصميم التجريبي ، ليس من الممكن استنتاج بدقة أين يعمل الكحول في المسار الاصطناعي لهرمون التستوستيرون ، على الرغم من أنه يبدو من المحتمل وجود أكثر من موقع واحد للعمل. يدرس الباحثون حاليًا تأثيرات الكحول على كل من الخطوات الجزيئية الأساسية لتصنيع الإنزيمات في مسار التستوستيرون وسلائف الستيرويد لهرمون التستوستيرون. يستكشف الباحثون أيضًا استراتيجيات لمنع التأثيرات القمعية للكحول على تخليق التستوستيرون. تتضمن إحدى هذه الإستراتيجيات إعطاء ذكور الفئران كريات التستوستيرون لتحل محل التستوستيرون ، وتتضمن الطرق الأخرى منع تدهور هرمون التستوستيرون بمثبطات الأروماتاز ​​(الأروماتاز ​​هو إنزيم رئيسي يشارك في تحويل هرمون التستوستيرون إلى هرمون الاستروجين) مثل فادروزول.

الشكل 2 مسار التستوستيرون التخليقي الحيوي. إنزيمات متعددة ضرورية لتكوين هرمون التستوستيرون. تظهر هذه على يمين الأسهم. تشير الأسهم إلى سلائف الستيرويد المختلفة لهرمون التستوستيرون التي يتم تصنيعها في كل خطوة.

StAR = بروتين تنظيمي حاد ستيرويدوجينيك

آليات ضرر الخصية الناجم عن الكحول

على الرغم من أنه من المعروف جيدًا أن تعاطي الكحول المزمن يؤدي إلى اختلال وظيفي جنسي ويضعف إنتاج الحيوانات المنوية في كل من البشر والحيوانات (Yen and Jaffe 1991) ، إلا أن آليات هذا الضرر الناجم عن الكحول لم يتم شرحها بالكامل. يتم وصف العديد من الآليات الممكنة أدناه.

أفيونيات المفعول. المواد الأفيونية الخصية هي جزيئات رسول تشبه المورفين ، عندما يتم إنتاجها داخل الخصيتين ، فإنها تثبط تخليق التستوستيرون. ثبت أن أحد المواد الأفيونية ، المعروف باسم بيتا إندورفين ، يزداد مع استهلاك الكحول الحاد والمزمن ، وبالتالي قد يكون رابطًا واحدًا بين تعاطي الكحول وتلف الخصية. على سبيل المثال ، يمنع بيتا إندورفين المنتج داخل الخصيتين إنتاج هرمون التستوستيرون في الخصية وإفرازه (جيانولاكيس 1990). وبالمثل ، ينتج عن بيتا إندورفين المنتج في منطقة ما تحت المهاد انخفاض مستويات هرمون LHRH. بالإضافة إلى ذلك ، قد تزيد المواد الأفيونية من موت الخلايا المبرمج (أي موت الخلايا المبرمج) (Yin et al. 1999 Nanji and Hiller-Sturmh fel 1997). سيؤدي موت الخلايا المبرمج على مستوى الغدد التناسلية إلى موت كل من Leydig والخلايا المنوية ، وهي خلايا تشارك في تكوين خلايا الحيوانات المنوية ونضجها ، مما يؤدي ليس فقط إلى انخفاض هرمون التستوستيرون ولكن أيضًا إلى تناقص إنتاج الحيوانات المنوية. في كل من الفئران البالغة وذكور البلوغ ، نجح العلاج بمضادات الأفيون (أي المواد الكيميائية التي تمنع المواد الأفيونية من الارتباط بمستقبلاتها في الدماغ) النالوكسون والنالتريكسون (ReVia T) في منع تثبيط التستوستيرون الناجم عن الكحول (جيانولاكيس 1990) .

أكسيد النيتريك. هناك طريقة أخرى لتقليل التأثيرات الضارة للكحول على إنتاج هرمون التستوستيرون وهي أكسيد النيتريك (NO) ، وهو غاز في كل مكان يؤدي إلى تمدد الأوعية الدموية أو توسع الأوعية. يتم تصنيع NO في الخصيتين بواسطة إنزيم رئيسي ، NO synthase (NOS) ، وتثبيط هذا الإنزيم بواسطة مجموعة متنوعة من مثبطات NOS يمنع بنجاح انخفاض هرمون التستوستيرون المرتبط باستهلاك الكحول (Adams et al. 1992). لذلك ، قد تتضمن التدخلات المستقبلية التي تهدف إلى منع أو عكس قمع الغدد التناسلية الناجم عن الكحول (أي انخفاض في إنتاج الحيوانات المنوية والتستوستيرون) منع تخليق NO.

أكسدة. الأكسدة 1 (1 تفاعلات الأكسدة هي تلك التي تزيل الهيدروجين من مادة أو تضيف الأكسجين إليها (أو كليهما).) للكحول ، وهي عملية تحدث كجزء من استقلاب الكحول ، تولد منتجات ثانوية تسمى المؤكسدات التي يمكن أن تسهم في تلف الخلايا و قد تلعب دورًا في تلف الأنسجة الناجم عن الكحول في الخصيتين. يمكن أن يؤدي عدم التوازن بين المواد المؤكسدة ومضادات الأكسدة (أي المواد التي تحيد الأكسدة) إلى حدوث إجهاد تأكسدي ، وهي حالة تتميز باستمرار إنتاج العوامل المؤكسدة وتلف الخلايا المتصاعد. زيادة الإجهاد التأكسدي هي آلية مقبولة جيدًا لإصابة الأنسجة التي يسببها الكحول ، خاصة في الكبد (Sies 1997 Aleynik et al. 1998 Polavarapu et al. 1998) والقلب والجهاز العصبي المركزي ، وهناك بعض المعلومات التي تشير إلى أن هذا أيضًا يحدث في الخصيتين (إيمانويل وآخرون 2001). قد يؤدي استهلاك الكحول إلى حدوث أضرار مؤكسدة إما عن طريق تعزيز إنتاج مركبات سامة تسمى الجذور الحرة أو عن طريق تقليل مستويات مضادات الأكسدة.

تُعرف بعض المؤكسدات التي ينتجها استقلاب الكحول بأنواع الأكسجين التفاعلية (ROS). وتشمل هذه العناصر فوق أكسيد الأنيون ، وبيروكسيد الهيدروجين ، وجذور الهيدروكسيل ، وأنواع تفاعل النيتروجين مثل أكسيد النيتروجين. ينتج عن استقلاب الكحول والأسيتالديهيد ، وهو المنتج الأساسي لاستقلاب الكحول ، أنواع الأكسجين التفاعلية شديدة السمية. تشير بعض البيانات إلى أن الأسيتالديهيد في الواقع أكثر سمية من الكحول لإنتاج هرمون التستوستيرون ، مما يغير عملية إنتاج هرمون التستوستيرون عن طريق تثبيط بروتين كيناز سي ، وهو إنزيم رئيسي في تخليق التستوستيرون (أندرسون وآخرون ، 1985 تشياو وفان ثيل 1983). أظهر بحث إضافي أن الرجال الذين يعانون من إدمان الكحول المزمن وقصور الغدد التناسلية في الواقع يزيلون الكحول بسرعة أكبر ، مما يقلل من الأسيتالديهيد. نظرًا لأن تراكم الأسيتالديهيد في الجسم يسبب الغثيان ، فإن التخلص المعزز من هذا المنتج الثانوي يمكن أن يؤدي إلى تقليل الآثار الجانبية المعدية المعوية الناتجة عن الشرب (على سبيل المثال ، الانزعاج البطني والقيء) لدى الرجال الذين يعانون من انخفاض مستويات هرمون التستوستيرون. قد يزيد هذا من خطر الإصابة بمشكلة الشرب ، لأن الشخص الذي لا يعاني من الآثار الجانبية المعدية المعوية السلبية للشرب سيكون أكثر عرضة للاستمرار في الشرب ، غالبًا بكميات أكبر (Vaubourdolle et al.1991).

تلف الخلايا. نظرًا لأن أغشية الخصية غنية بالجزيئات المعروفة باسم الأحماض الدهنية (أي الدهون) ، والتي تكون عرضة للإصابة بالأكسدة ، فمن المعقول اعتبار أن أكسدة الدهون (أي تلف أغشية الخلايا) قد تساهم في الخلل الوظيفي للغدد التناسلية الذي يحدث مثل نتيجة الاستخدام الحاد أو المزمن للكحول. يمكن تخفيف الضرر الناتج عن الأكسدة باستخدام مكملات فيتامين أ الغذائية (Sies 1997). يعمل فيتامين أ كمضاد للأكسدة ، ويعمل على استقرار أغشية خلايا الخصية عن طريق تقليل بيروكسيد الدهون ويمنع الضمور الناجم عن الكحول الذي يحدث في الحيوانات التي لا تتلقى نظامًا غذائيًا غنيًا بفيتامين أ. مجتمعة ، تشير هذه الملاحظات إلى أن بيروكسيد الخصية المعزز الذي يحدث بعد استهلاك الكحول قد يكون عاملاً مهمًا في التسبب في إصابة الغدد التناسلية المرتبطة بالكحول وأن الأنظمة الغذائية الغنية بفيتامين أ يمكن أن تساعد في مواجهة هذه الإصابة. يجري البحث حاليًا لفحص دور الإصابة التأكسدية في قصور الغدد التناسلية الناجم عن الكحول.

بالإضافة إلى تلف الغشاء ، قد تترافق أنواع إضافية من تلف الخلايا مع تلف الخصية الناجم عن الكحول. يؤدي الاستهلاك المفرط للكحول لفترات طويلة إلى تلف الخلايا الشديد الذي يؤدي إلى موت الخلايا. يحدث موت الخلية عبر آليتين متميزتين: النخر والاستماتة. يحدث النخر عندما يتسبب التعرض لمحفز ضار ، مثل الكحول ، في فقدان وظائف التمثيل الغذائي للخلية وتلف غشاء الخلية. في موت الخلايا المبرمج ، تشارك الخلية بنشاط في عمليات موت الخلية عن طريق تنشيط سلسلة من التفاعلات الكيميائية الحيوية التي تؤدي في النهاية إلى انكماش الخلية وتفتت النواة. عندما تخضع الخلية للاستماتة ، تنفصل الخلية بأكملها ، بما في ذلك النواة ، إلى أجزاء عديدة (أي أجسام موت الخلايا المبرمج) (Nanji and Hiller-Sturmh fel 1997).

في أي عضو ، يؤدي التعرض الحاد والمزمن للكحول إلى نخر الخلية وكذلك موت الخلايا المبرمج ، ويلعب الإجهاد التأكسدي دورًا مهمًا في كلتا العمليتين. هذا صحيح أيضًا بالنسبة لخلية الخصية الجرثومية (أي خلية مهمة في نمو الحيوانات المنوية ونضجها). تؤدي الإصابة التأكسدية إلى اضطراب أغشية الخلايا وفي النهاية تمزقها ، مما يؤدي إلى موت الخلايا الميتة. علاوة على ذلك ، يمكن لأكسدة الإنزيمات أن تمنع عمليات التمثيل الغذائي الضرورية لعمل الخلايا وإصلاحها. يُفترض أن يمثل موت الخلايا المبرمج آخر مسار مشترك لإصابة الخلايا بوساطة ROS. يحدث هذا مباشرة عن طريق الجذور الحرة للأكسجين. على الرغم من أنه يمكن أيضًا تحفيز موت الخلايا المبرمج للخلايا الجرثومية بواسطة محفزات تنظيمية غير هرمونية مختلفة ، بما في ذلك سموم الخصية ، والإجهاد الحراري ، وعوامل العلاج الكيميائي ، فإن الآليات التي تنظم بها هذه العوامل الهرمونية وغير الهرمونية موت الخلايا المبرمج للخلايا الجرثومية ليست مفهومة جيدًا (Hikim and Swerdloff 1999). يمكن أيضًا أن يحدث موت الخلايا المبرمج بشكل غير مباشر بسبب عدم التوازن بين الأكسدة والاختزال 2 (2 ذرات الهيدروجين التي يتم إزالتها أثناء الأكسدة يتم نقلها إلى جزيء آخر ، وبالتالي يتم تقليله & # 148. & # 148 وبالتالي ، فإن الأكسدة والاختزال عمليات مكملة ، لأن تستلزم أكسدة مادة ما اختزال مادة أخرى. هذه العملية ، التي تحرك ذرات الهيدروجين ذهابًا وإيابًا بين الأكسدة وتفاعلات الاختزال # 150 ، تساعد في الحفاظ على التوازن المناسب بين الأكسدة والاختزال في الخلية.) العمليات في الخلية ومن خلال التعبير عن جزيئات تعزيز الالتهاب تسمى السيتوكينات. سيؤدي العمل الجاري في مجال الاستماتة التي يسببها الكحول على مستوى الغدد التناسلية إلى توسيع المعرفة في هذا المجال.

آليات محتملة أخرى. تتضمن التفسيرات الأخرى لقمع الغدد التناسلية المرتبط بالكحول استقلاب الكحول إلى أسيتو أسيتات ، وهو مركب شديد السمية ، وعوامل سامة أخرى تتشكل من أسيتات أسيتات ، مثل سالسولينول (Stumble et al.1991). وبالمثل ، قد يحفز الكحول مستويات مرتفعة من البرولاكتين النخامي والسيتوكينات المعززة للالتهاب في الدماغ ، والتي قد تكون مسؤولة عن تثبيط هرمون التستوستيرون في الغدد التناسلية. الاضطرابات في مكونات النظام الهرموني الأخرى التي تتفاعل مع محور HPG ، مثل الغدة الكظرية ، تلعب أيضًا دورًا في تثبيط هرمون التستوستيرون التناسلي (Ogilvie and Rivier 1997). تعتبر تأثيرات أمراض الكبد على استقلاب المنشطات التناسلية والمستويات المنتشرة من المنشطات التناسلية مهمة أيضًا لفهم قصور الغدد التناسلية الناجم عن الكحول (ليبر 1994). هذه الآثار خارج نطاق هذه المراجعة ، ومع ذلك.

الكحول ووحدة الغدة النخامية للذكور

تركزت الأبحاث حول تأثيرات الكحول على منطقة ما تحت المهاد والغدة النخامية على تأثيرات هرمونات LHRH ، التي تنتجها منطقة ما تحت المهاد ، و LH و FSH ، التي تنتجها الغدة النخامية. في حين ذكرت بعض الدراسات أن إفراز هرمون LHRH ينخفض ​​بعد تناول الكحول بشكل حاد ، بينما أشارت دراسات أخرى إلى عدم وجود أي تأثير (انظر Emanuele et al. 1993) ، فإن قدرة ذكر منطقة ما تحت المهاد على تخليق هذا الهرمون المهم يبدو أنها لم تتغير بسبب الكحول في أي جرعة (إيمانويل وآخرون 1993).

يتم تنظيم إفراز هرمون LHRH عن كثب من خلال سلسلة من الآليات المعقدة التي تتضمن نبضات عصبية مختلفة متولدة خارج منطقة ما تحت المهاد. يمكن أن يؤثر الكحول على أي من هذه المحفزات. تؤدي العمليات والمركبات المتعددة ، بما في ذلك المواد الأفيونية ، إلى تنشيط مولد النبض LHRH ، وهو جزء من منطقة ما تحت المهاد المسؤول عن إفراز هرمون LHRH (جيانولاكيس 1990). تلعب المواد الكيميائية الأخرى في الدماغ والإشارات العصبية أيضًا دورًا في إفراز هرمون LHRH وقد تتأثر سلبًا بالكحول. ومع ذلك ، يبدو أن هذا المستوى الأعلى من المحور التناسلي ، الوطاء ، هو الأقل عرضة للعواقب الوخيمة للكحول.

قام الباحثون أيضًا بتقييم تأثير الكحول على LH و FSH ، وهي موجهة الغدد التناسلية النخامية المسؤولة عن وظيفة الغدد التناسلية. أظهرت الدراسات التي أجريت على الحيوانات والبشر أنه عندما تنخفض مستويات هرمون التستوستيرون ، لا تزيد مستويات LH كما هو متوقع. إن عدم قدرة الغدة النخامية على الاستجابة بشكل مناسب لانخفاض هرمون التستوستيرون يعني أن الكحول له تأثير مركزي على التفاعل بين الجهاز العصبي ونظام الغدد الصماء (Hadley 1988 Yen and Jaffe 1991).

أثبتت الدراسات التي أجريت على الفئران التي تتغذى على الكحول أن الانخفاض في مستويات LH ناتج عن ضعف في كل من إنتاج LH وإفراز LH ، وقد حاول الباحثون تحديد الخطوات المحددة في إنتاج LH وإفرازه التي تتأثر بالكحول (Salonen et al.1992) إيمانويل وآخرون 1993). يبدأ إنتاج LH من خلال تفاعل LHRH المنطلق من منطقة ما تحت المهاد مع مستقبلات LHRH محددة.

ينشط هذا التفاعل سلسلة من الأحداث الأنزيمية في خلايا الغدة النخامية. يمكن للكحول أن يعطل عمل مستقبلات LHRH أو تفاعله مع LHRH ، مما يؤدي إلى تناقص إطلاق LH. لم يتم العثور على دليل يشير إلى أن الكحول يضعف تفاعل LHRH مع مستقبلاته ، ولكن الكحول قد يؤثر على الأحداث اللاحقة. على وجه التحديد ، أفاد الباحثون أن الكحول يضعف وظيفة بروتين كيناز سي ، وهو إنزيم رئيسي في إنتاج الهرمون اللوتيني ، وأن الكحول يضعف الخطوات الأخرى الحاسمة لتخليق وإفراز الهرمون اللوتيني. أظهر بحث إضافي مع الفئران أن الكحول يضعف إنتاج LH عن طريق تقليل قدرة المادة الوراثية LH على الارتباط بأجزاء الخلية (أي الريبوسومات) حيث يحدث تخليق البروتين.

بالإضافة إلى خفض مستويات LH في الدم ، قد يؤثر الكحول على نشاط جزيء LH ، مما يجعله أقل قدرة على تحفيز إنتاج الهرمونات في الخصيتين. مثل العديد من الهرمونات الأخرى ، فإن LH ليس بروتينًا بسيطًا ولكنه بروتين ترتبط به الكربوهيدرات المختلفة (أي البروتين السكري). يحدد عدد وأنواع الكربوهيدرات المرتبطة بالبروتين قدرة الهرمون على تحفيز إنتاج هرمون التستوستيرون (أي قدرته البيولوجية). توجد متغيرات عديدة للهرمون اللوتيني مع الكربوهيدرات المرفقة المختلفة والفاعلية المختلفة. لقد ثبت أن الكحول يؤدي إلى إنتاج جزيئات LH أقل قوة. لذلك ، فإن التأثيرات الضارة للكحول على وظيفة LH نوعية وكمية.

في حين تتوفر معلومات أقل عن تأثير الكحول على FSH ، يبدو أيضًا أن إفراز هرمون الغدد التناسلية ينخفض ​​بسبب الكحول. لا يبدو أن الكحول يؤثر على تخليق FSH (Emanuele et al.1993).

الكحول ، المواد الأفيونية ، والتكاثر

يصنع بيتا إندورفين أفيوني المفعول في منطقة ما تحت المهاد وكذلك في أجزاء أخرى من الدماغ والغدة النخامية والخصيتين. يحد بيتا إندورفين الهايبوثالاميك من إفراز هرمون LHRH في الوطاء وبالتالي فهو مثبط لمحور HPG. يزداد هرمون بيتا إندورفين تحت المهاد مع كل من التعرض الحاد والمزمن للكحول (Gianoulakis 1990) ، وقد وجد أن زيادة بيتا إندورفين تؤدي إلى قمع LHRH تحت المهاد والغدة النخامية وتخليق التستوستيرون ، كما لوحظ سابقًا. الحيوانات المعرضة للكحول والبشر لديهم أيضًا مستويات عالية من هرمون الاستروجين المعروف باسم استراديول. هذا مهم ، لأن الإستراديول معروف بقدرته على تعزيز إفراز بيتا إندورفين. وبالتالي ، قد يزيد الكحول من المواد الأفيونية بشكل مباشر وغير مباشر ، على الرغم من أن حجم التغيير غير معروف.

نظرًا لأنه من المعروف أن المواد الأفيونية تلعب دورًا في الإصابة بالأكسدة ، فمن المعقول أن العلاج باستخدام النالتريكسون ، وهو أحد حاصرات المواد الأفيونية ، قد يمنع هذه الإصابة. يعد استخدام النالتريكسون لتحقيق مثل هذه الوقاية أمرًا مهمًا للغاية ، حيث أن النالتريكسون دواء يستخدم بالفعل سريريًا لتقليل الرغبة الشديدة في تناول الكحول. كما هو مذكور أعلاه ، فقد ثبت أن حاصرات المواد الأفيونية تساعد في منع تثبيط هرمون التستوستيرون الناجم عن الكحول المرتبط بالمواد الأفيونية. قد تلعب المواد الأفيونية أيضًا دورًا في التوسط في الإجهاد التأكسدي والاستماتة. يستحق مجال حصار المواد الأفيونية اهتمامًا واسعًا.

آثار التعرض للكحول الوراثي على المحور التناسلي

تناولت دراسات قليلة آثار تعاطي الوالد الذكر للكحول على قدرته الإنجابية وصحة نسله (بيلاوسكي و أبيل 1997 أبيل 1995). كنموذج لشرب الكحول في سن المراهقة ، درس الباحثون آثار التعرض للكحول على ذكور الجرذان في سن البلوغ. أظهر هذا البحث الآثار الضارة لاستهلاك الكحول من الأب على النسل. نتج عن شهرين من إطعام ذكور الحيوانات بالكحول أثناء تقدمها خلال فترة البلوغ انخفاض أوزان أجسامهم وانخفاض مستويات هرمون التستوستيرون ، مقارنة بالحيوانات التي لم تتناول الكحول. على الرغم من ذلك ، بعد أسبوع من الامتناع عن تناول الكحول ، تمكنت تلك الحيوانات من التزاوج بنجاح ، على الرغم من أن التزاوج الناجح الذي أدى إلى الحمل (أي الخصوبة) انخفض بشكل كبير وتناقص عدد حالات الحمل الناجحة.

على الرغم من انخفاض حجم القمامة للذكور المعرضين للكحول بنسبة 46 في المائة ، كان متوسط ​​الوزن الفردي لنسل صغار الحيوانات المعرضة للكحول أعلى. كما تم تغيير نسبة الذكور إلى الإناث ، مع وجود نسبة أعلى من الذكور من الآباء الذين يتغذون على الكحول. لم يلاحظ أي تشوهات جسيمة بين الجراء.

تم زيادة الإصابة التأكسدية للخصية الأبوية ، كما يتضح من زيادة بيروكسيد الدهون. كما ارتفع موت الخلايا المبرمج للخلايا الجرثومية لدى الآباء المعرضين للكحول (Emanuele et al.2001). لذلك ، يبدو أن التعرض المزمن للكحول في الفئة العمرية في الفترة المحيطة بالبلوغ يقلل من الخصوبة ، والتي يمكن أن تتوسطها إصابة الخصية المؤكسدة ، مما يؤدي إلى موت الخلايا المبرمج للخلايا الجرثومية المتسارع في الآباء المعرضين للكحول. هذا مجال مثير آخر لمزيد من التحقيق.

الكحول واللبتين والتكاثر

اللبتين ، الهرمون الذي ينظم الشهية الذي تم اكتشافه في عام 1994 ، له آثار تتجاوز دوره المحدد في الأصل. يبدو أن لها دورًا واسعًا في محور HPG وما بعده ، لكل من الرجال والنساء. في محور HPG ، يبدو أن اللبتين يحفز LHRH و LH لكنه يثبط نشاط الغدد التناسلية (Hiney et al.1999).في الجرذان ، يحفز تناول الكحول لمدة شهر واحد هرمون اللبتين (نيكولاس وآخرون 2001) ، مما يمثل آلية أخرى محتملة ومثيرة للاهتمام لقصور الغدد التناسلية الناجم عن الكحول.

أدى البحث على مدى السنوات الخمس والعشرين الماضية إلى توسيع نطاق المعرفة بتأثير الكحول على تكاثر الذكور. تشمل المناطق الخصبة للتحقيق آليات الضرر التأكسدي الناجم عن الكحول وموت الخلايا المبرمج في الخصيتين ، وعواقب تعرض الأب للكحول على نسلهم ، وتأثيرات تعاطي الكحول على تكاثر اللبتين والذكور. بالإضافة إلى ذلك ، فإن الوقاية العملية من قمع الخصية باستخدام النالتريكسون وعدم التثبيط هي تدخلات علاجية واعدة.

أبيل ، إل. تأثير مدهش للعلاج الأبوي بالكحول على أجنة الفئران. كحول 12(1):1ע, 1995.

آدمز ، م. نوك ، ب. ترون ، ر. وسيسيرو ، ت. السيطرة على أكسيد النيتريك في تكوين الستيرويد: تأثيرات الغدد الصماء لـ N G -nitro-L-arginine ومقارنتها بالكحول. علوم الحياة 50: PL35 & # 150PL40، 1992.

ALEYNIK ، S.I.Lo ، M.A. ALEYNIK ، M.K. and LIEBER، CS زيادة المنتجات المتداولة من بيروكسيد الدهون في المرضى الذين يعانون من مرض الكبد الكحولي. إدمان الكحول: البحوث السريرية والتجريبية 22: 192𤪴, 1998.

أندرسون ، ر. JR. عرض QUIGG ، J.M. OSWALD ، C. and ZANEVELD ، L.J. دليل على نقص تأثير الأسيتالديهيد على الاكتئاب الناجم عن الإيثانول لهرمون التستوستيرون في الجسم الحي. علم الأدوية البيوكيميائية 34(5):685𤲧, 1985.

آزاد ، إن أغراوال ، إل إمانويلي ، إم إيه كيلي ، م. و EMANUELE ، N.V. طب الغدد الصماء المناعية العصبية. المجلة الأمريكية لعلم المناعة الإنجابية 26: 160𤪜, 1991.

BERCZI، I. NAGY، E. KOVACS، K. and HORWATH، E. تنظيم المناعة الخلطية في الفئران عن طريق هرمونات الغدة النخامية. اكتا للغدد الصماء 98:506𤯱, 1981.

بيلاوسكي ، د.م. ، وابل ، إل. العلاج الحاد لتعرض الأب للكحول ينتج تشوهات في النسل. كحول 14(4):397𤮁, 1997.

CHIAO ، Y.B. ، و VAN THIEL ، D.H. الآليات البيوكيميائية التي تساهم في قصور الغدد التناسلية الناجم عن الكحول في الذكور. إدمان الكحول: البحوث السريرية والتجريبية 7(2):131𤩶, 1983.

سيسيرو ، ت. العجز الناجم عن الكحول في محور الهرمون الوطائي - النخامي - اللوتيني في الذكر. إدمان الكحول: البحوث السريرية والتجريبية 6:207𤫇, 1982.

إمانويلي ، ماجستير هلوران ، م. أودن ، إس تينتلر ، جيه إيمانويلي ، إن في لورنس ، إيه. وآخرون. آثار الكحول على التحكم في الغدد الصماء العصبية للتكاثر. في: Zakhari، S.، ed.، الكحول ونظام الغدد الصماء: NIAAA Research Monograph رقم 23 ، Bethesda، MD: National Institute on Alcohol Abuse and Alcoholism، 1993. pp. 89 & # 150116.

EMANUELE ، N.V. LAPAGLI ، N. STEINER ، J. COLANTONI ، A. VAN THIEL ، D.H. and EMANUELE ، M.A. Peripubertal الأب التعرض EtOH. الغدد الصماء14(2): 213ץ, 2001.

جيانولاكيس ، ج. توصيف تأثيرات إعطاء الإيثانول الحاد على إطلاق ببتيدات بيتا إندورفين بواسطة الوطاء الجرذ. المجلة الأوروبية لعلم الأدوية 180:21㪵, 1990.

جيانولاكيس ، ج.تأثير الإيثانول على التخليق الحيوي وتنظيم الببتيدات الأفيونية. اكسبرينتيا 45:428𤮣, 1989.

هادلي م. طب الغدد الصماء. الطبعة الثانية. إنجليوودز كليف ، نيوجيرسي: برنتيس هول ، 1988.

هيكيم ، أ.ب. ، وسويردلوف ، ر. السيطرة الهرمونية والوراثية على موت الخلايا المبرمج للخلايا الجرثومية في الخصيتين. تقييمات الاستنساخ 4:38㫇, 1999.

هيني ، ج. دير ، ر. لارا ، ف ، الثالث. WOOD، S. SRIVASTAVA، V. and DEES، W.L. آثار الإيثانول على إفراز اللبتين وهرمون اللبتين الناجم عن اللبتين (LH) المنطلق من إناث الفئران الشابة المتأخرة. إدمان الكحول: البحوث السريرية والتجريبية 23(11): 1785�, 1999.

JACKSON، J.، and KLEREKOPER، M. ترقق العظام عند الرجال: التشخيص والفيزيولوجيا المرضية والوقاية. طب 69:137𤪈, 1990.

كلاين ، ر. ، ودوال ، إ. فقدان العظام عند الرجال: التسبب في المرض والاعتبارات العلاجية. أخصائي الغدد الصماء 4:252𤫽, 1994.

LIEBER ، CS الآثار الكبدية والتمثيل الغذائي للإيثانول: التسبب في المرض والوقاية. حوليات الطب 26(5): 325𤬺, 1994.

ليتل ، بي جيه آدامز ، م. وسيسيرو ، ت. آثار الكحول على المحور الوطائي - النخامي - التناسلي في ذكور الجرذ النامي. مجلة علم الأدوية والعلاجات التجريبية 263(3):1056�, 1992.

NANJI، A.A.، and HILLER-STURMH & OumlFEL، S. الاستماتة والنخر: نوعان من موت الخلايا في مرض الكبد الكحولي. عالم الكحول والصحة والبحوث 21:325𤬺, 1997.

نيكولاس ، جيه إم فرنانديز سولا ، جيه فاتجو ، إف كازاميتجانا ، آر باتالر ، آر ساكانيلا ، إي وآخرون. زيادة مستويات اللبتين المنتشرة في إدمان الكحول المزمن. إدمان الكحول: البحوث السريرية والتجريبية 25(1):83㫰, 2001.

OGILVIE ، K.M. ، و RIVIER ، C. الاختلاف بين الجنسين في استجابة محور الوطاء - الغدة النخامية - الكظرية للكحول في الجرذ: الدور التنشيطي للستيرويدات التناسلية. بحوث الدماغ 766(1מ):19㪴, 1997.

بولافارابو ، آر سبيتز ، د. SIM ، J.E. FOLLANSBEE ، M.H. أوبرلي ، إل دبليو. رحمت الله ، إيه وآخرون. ترتبط زيادة بيروكسيد الدهون وضعف وظيفة إنزيم مضادات الأكسدة بإصابة الكبد المرضية في مرض الكبد الكحولي التجريبي في الفئران التي تتغذى على وجبات غنية بزيت الذرة وزيت السمك. أمراض الكبد 27: 1317�, 1998.

SALONEN ، I. PAKARINEN ، P. and HUHTANIEMI ، I. تأثير نظام الإيثانول المزمن في التعبير عن جينات الغدد التناسلية في ذكور الجرذان. مجلة علم الأدوية والعلاجات التجريبية 260: 463𤯃, 1992.

SIES، H. الأكسدة: المواد المؤكسدة ومضادات الأكسدة. علم وظائف الأعضاء التجريبي 82:291𤬗, 1997.


& # 8217s كل شيء عن الذوبان & # 8230

أولاً ، نحتاج إلى معرفة سبب ذوبان الأحماض النووية في الماء. الماء جزيء قطبي - له شحنة سالبة جزئية بالقرب من ذرة الأكسجين بسبب أزواج الإلكترونات غير المشتركة ، وشحنات موجبة جزئية بالقرب من ذرات الهيدروجين. بسبب هذه الشحنات ، يمكن للجزيئات القطبية مثل DNA أو RNA أن تتفاعل كهروستاتيكيًا مع جزيئات الماء ، مما يسمح لها بالذوبان في الماء بسهولة. لذلك يمكن وصف الجزيئات القطبية بأنها جزيئات محبة للماء وغير قطبية ، والتي يمكن أن تتفاعل بسهولة مع جزيئات الماء ، فهي كارهة للماء. الأحماض النووية محبة للماء بسبب الفوسفات سالب الشحنة (PO3 & # 8211) على طول العمود الفقري للسكر والفوسفات.


التشخيص التشخيص

غالبًا ما يكون إجراء تشخيص لمرض وراثي أو نادر أمرًا صعبًا. عادةً ما ينظر اختصاصيو الرعاية الصحية إلى التاريخ الطبي للشخص والأعراض والفحص البدني ونتائج الاختبارات المعملية من أجل إجراء التشخيص. توفر الموارد التالية معلومات تتعلق بالتشخيص والاختبار لهذه الحالة. إذا كانت لديك أسئلة حول الحصول على التشخيص ، فيجب عليك الاتصال بأخصائي الرعاية الصحية.

موارد الاختبار

  • يوفر سجل الاختبارات الجينية (GTR) معلومات حول الاختبارات الجينية لهذه الحالة. الجمهور المستهدف لـ GTR هو مقدمو الرعاية الصحية والباحثون. يجب على المرضى والمستهلكين الذين لديهم أسئلة محددة حول الاختبار الجيني الاتصال بمقدم الرعاية الصحية أو أخصائي علم الوراثة.

المقدمة

قليل النوكليوتيدات المضادة المعنى (ASOs) التي تحتوي على جزء oligodeoxynucleotide المركزي المحاط بـ 2 نيوكليوتيدات معدلة في كلا الطرفين ، والمعروفة باسم ASOs ، يمكن تهجينها مع RNAs التكميلية وتحفيز انقسام RNase H1 ، مما يؤدي إلى تدهور محدد للحمض النووي الريبي (1). ASOs المعدلة كيميائيًا التي تحتوي على العمود الفقري للفوسفوروثيوات (PS) وتعديلات مختلفة 2 ، على سبيل المثال يمكن توصيل 2 ميثوكسي إيثيل (MOE) إلى أنسجة وخلايا مختلفة لاستثارة نشاط مضاد للحساسية في الجسم الحي و في المختبر (2 ، 3). على الرغم من أن معظم ASOs فعالة في الحد من استهداف الحمض النووي الريبي (RNAs) ولها مدة نشاط طويلة ، كاستجابة شائعة للتدخلات الدوائية (4) ، يمكن لبعض ASOs إظهار تأثيرات التسامح. على سبيل المثال ، من الصعب تقليل بعض أهداف mRNA باستخدام ASOs التي تعمل بنظام فجوة وبعض ASOs تعرض مدة نشاط أقصر من تقليل الهدف المطول الذي يتم ملاحظته عادةً لمعظم ASOs. ومع ذلك ، لا يُعرف سوى القليل جدًا عن الآلية (الآليات) المحتملة المسؤولة عن تحمل ASO.

لقد ثبت أن ASOs نشطة في كل من النواة والسيتوبلازم ، حيث يوجد RNase H1 (5). على سبيل المثال ، يمكن تقليل فعالية ما قبل الرنا المرسال النووي وغير المشفر بواسطة ASOs (6-9). من ناحية أخرى ، يمكن أيضًا أن تتحلل mRNAs الناضجة بسرعة في السيتوبلازم عند تعداء ASOs التي تستهدف exon (5). يمكن لبعض ASOs التي تستهدف exon أن تقلل من كل من mRNA الناضج و pre-mRNA ، اللذين يتم إثرائهما في السيتوبلازم والنواة ، على التوالي. ومع ذلك ، يمكن لبعض ASOs التي تستهدف exon أن تقلل بسرعة من مستويات mRNAs الناضجة ولكن ليس ما قبل mRNAs (5) ، مما يشير إلى إمكانية وصول مختلفة لـ ASOs إلى نفس التسلسل الموجود في كل من mRNA و pre-mRNA. يتم دعم هذا الرأي أيضًا من خلال الملاحظات التي تفيد بأن ASOs التي تستهدف snoRNAs المشفر intron يمكن أن تقلل بكفاءة مستويات snoRNAs الناضجة ، دون التأثير على مستويات المضيف pre-mRNAs (6). ومع ذلك ، يمكن أن يتحلل وسيط الربط الذي يحتوي على snoRNA بواسطة ASOs (5).

بالإضافة إلى ذلك ، بعد تهجين ASO-RNA ، يمكن تجنيد بروتينات أخرى في ASO / RNA heteroduplex ، مما يؤثر على انقسام RNase H1 ، ويمكن أن يعدل مصير RNA عن طريق تشغيل آليات ما بعد التهجين المختلفة (3). على سبيل المثال ، يمكن لبروتينات Ku70 و P54nrb و HspA8 ربط ASO / RNA heteroduplex وتمنع تجنيد RNase H1 وانقسام الحمض النووي الريبي (10 ، 11). تشير هذه الملاحظات إلى أن الحمض النووي الريبي الناضج والسلائف قد تتبنى هياكل مختلفة أو ترتبط ببروتينات مختلفة ، مما يؤدي إلى تغيير إمكانية الوصول إلى ASOs ، والتي تعتمد على الأرجح على موقع الهدف ASO الموجود في RNA ، و / أو توطين الحمض النووي الريبي في الخلايا. بالإضافة إلى ذلك ، وجدنا مؤخرًا أيضًا أن ASO الذي يستهدف الرنا الريباسي 5S قلل من مستوى الرنا الريباسي 5S الناضج ، ولكنه تسبب في تراكم أنواع الرنا الريباسي التي تمت معالجتها بشكل غير كامل قبل 5S في النواة ، بطريقة تعتمد على تهجين ASO / RNA (12) ، وكذلك تسليط الضوء على تعقيد آليات مضادات المعنى المحتملة الناتجة عن تهجين ASO لاستهداف الحمض النووي الريبي.

في خلايا الثدييات ، يتم نسخ معظم جينات تشفير البروتين على أنها ما قبل mRNAs في النواة ، حيث تتم معالجة ما قبل mRNAs عن طريق إزالة intron (الربط) ، وتعديل النيوكليوتيدات ، وتغطية 5 و 3 نهاية لتوليد mRNAs ناضجة (13-15 ). ثم يتم تصدير mRNAs الناضجة إلى السيتوبلازم وتتراكم فيه ، ويتم ترجمتها بواسطة الريبوسومات (16). يتم تحديد مستويات الحالة المستقرة من الرنا المرسال من خلال معدل تخليق الرنا المرسال وتدهور الرنا المرسال. عادةً ما تخضع الرنا المرسال لعملية التحلل التي تتضمن إزالة الغشاء وإزالة الأدينيل والنوكلياز الخارجي مثل XRN1 والإكسوسومات (17). ومع ذلك ، يمكن لبعض mRNAs التي تحتوي على كودون إنهاء سابق لأوانه (PTC) أن تخضع للاضمحلال الوسيط غير المنطقي (NMD) ، الأمر الذي يتطلب عوامل NMD مثل UPF1 و UPF2 و UPF3 (18-20). يتم التعبير عن شكلين من UPF3 و UPF3A و UPF3B بشكل تفاضلي أثناء التطوير وقد يلعبان أدوارًا متعاكسة في NMD ، مع UPF3A كمانع و UPF3B كمحسن (21).

لقد ثبت أن مستويات الرنا المرسال يتم تخزينها جيدًا وأن تسوس أو تدهور الرنا المرسال السيتوبلازمي مرتبط بالنسخ (22-24) ، والذي يمكن التوسط فيه بواسطة عوامل الانحلال XRN1 والبروتينات المعقدة CCR4-CNOT (17). تنتقل هذه البروتينات بين السيتوبلازم والنواة بطريقة تعتمد على تدهور الرنا المرسال وتعزز النسخ من خلال الارتباط بمنطقة المروج (25). بالإضافة إلى ذلك ، في ظل بعض الطفرات الجينية ، يمكن تنظيم التعبير عن جينات المتجانسة من خلال الاستجابة التعويضية الجينية (GCR) (26) ، والتي يتم تشغيلها عن طريق تدهور PTC المحتوية على mRNAs المتحولة على الأرجح من خلال NMD (27) ، ولكن في UPF1 و UPF3B مستقلة بطريقة (28). ومع ذلك ، تتطلب هذه العملية عامل NMD UPF3A ، وبروتينات COMPASS المعقدة بما في ذلك WDR5 ، والمجمع الأخير مطلوب لميثيل هيستون (H3K4me3) في موقع بدء النسخ للجينات التعويضية لتعزيز النسخ (27 ، 28).

لقد وجدنا سابقًا أن ASO الذي يستهدف منطقة exon لـ SOD1 mRNA قلل من مستوى mRNA ، لكنه زاد بشكل مفاجئ من مستوى pre-mRNA الخاص به (5). تثير هذه الملاحظة احتمالية أن بعض ASOs قد تقلل تدريجياً من نشاط مضادات المعنى بسبب التسامح بوساطة زيادة مستويات ما قبل الرنا المرسال. ومع ذلك ، فمن غير الواضح ما إذا كانت هذه الملاحظة فريدة من نوعها لتلك ASO وما هي الآلية (الآليات) الأساسية التي قد تكون متورطة في زيادة ما قبل mRNA الناجم عن فجوة ASO. في الدراسة الحالية ، قمنا بتحليل تأثيرات ASOs المتعددة الخارجية التي تستهدف mRNAs المختلفة على مستويات ما قبل mRNAs ووجدنا أن بعض ASOs يمكن أن تزيد من مستويات pre-mRNAs في كل من خلايا الإنسان والفأر. علاوة على ذلك ، أظهرنا أن زيادة ما قبل الرنا المرسال تحدث بعد فترة وجيزة من تقليل الرنا المرسال ، وأن تقليل الرنا المرسال نفسه مطلوب ولكنه غير كافٍ لتحفيز زيادة ما قبل الرنا المرسال. بالإضافة إلى ذلك ، وجدنا أن زيادة ما قبل mRNA ترجع إلى النسخ المحسن ومن المحتمل أيضًا أن تكون المعالجة أبطأ ، وتعتمد على RNase H1 والترجمة ، وتتطلب UPF3A ولكن ليس WDR5. ومع ذلك ، فإن تقليل عوامل NMD الأخرى UPF1 و UPF2 و UPF3B لم يؤثر على زيادة ما قبل الرنا المرسال عند علاج ASO. علاوة على ذلك ، لا يتم التوسط في عملية زيادة ما قبل الرنا المرسال بواسطة مسار التغذية الراجعة XRN1-CNOT. الأهم من ذلك ، أن ASO الذي تسبب في زيادة ما قبل mRNA أظهر نشاطًا منخفضًا بعد الجرعات المتكررة في الحيوانات ، بما يتوافق مع الأنماط الظاهرية لتحمل الدواء. تشير هذه النتائج معًا إلى أن بعض ASOs التي تعمل بنظام فجوات يمكن أن تقلل من مستويات الرنا المرسال في السيتوبلازم ، ولكنها تؤدي إلى آلية تغذية مرتدة لتعزيز نسخ الجين المقابل ، مما يؤدي إلى زيادة مستويات ما قبل mRNA ، والتي يمكن أن تضعف نشاط ASO الكلي.


مقدمة

تُظهر أنابيب حبوب اللقاح تمددًا صارمًا للخلايا القطبية يسمى نمو الأطراف ، وهو مشابه لذلك الموجود في شعر الجذر. في بعض الأنواع النباتية ، يمكن أن يصل معدل نمو أنبوب حبوب اللقاح إلى ميكرومتر في الثانية (Stone et al. ، 2004). لتحقيق نمو سريع للغاية ، تحتاج أنابيب حبوب اللقاح إلى طاقة عالية تتطلب امتصاصًا سريعًا للأكسجين (Tadege and Kuhlemeier ، 1997) ، والكالسيوم الخلوي الحر ([Ca 2+]CYT) للتدرج دور حاسم في تعديل الاستطالة القطبية. أظهرت الدراسات الحديثة أن أنواع الأكسجين التفاعلية (ROS) كانت شرطًا لنمو شعر الجذور. استخدم فورمان وزملاؤه (فورمان وآخرون ، 2003) طفرة قاضية لفقدان الوظيفة في AtrbobC / RHD2 لإثبات أن ROS كان لا غنى عنه لنمو شعر الجذور وكان مطلوبًا لتحفيز تدفق Ca 2+ أثناء استطالة شعر الجذر. AtrbobC / RHD2 يشفر الأكسيد الفائق (O2• -) - أدى إنتاج NADPH أوكسيديز (NOX) والطفرة إلى تقليل تكوين ROS عند طرف الشعيرات الجذرية القصيرة جدًا. في وقت لاحق ، اكتشف Monshausen وزملاؤه (Monshausen et al. ، 2007) تذبذبات في تركيز ROS السكتة الدماغية في الجزء العلوي من أجنحة شعيرات الجذر ، مما كشف عن نموذج جديد لدور ROS في نمو شعر الجذور. بخلاف ذلك ، فقد تم إثبات أن هناك حاجة إلى أنواع ROS الموضعية التي ينتجها إنزيم NOX للحفاظ على المعدل الطبيعي لنمو أنبوب حبوب اللقاح (Potocky et al. ، 2007). تعتبر أنواع الأكسجين التفاعلية نتيجة حتمية لعملية التمثيل الغذائي الهوائي ، ولها مجموعة متنوعة من الوظائف بما في ذلك الدفاع عن مسببات الأمراض وإشارات الخلية. في الخلايا النباتية ، هناك العديد من المصادر المحتملة لـ ROS ، مثل البلاستيدات الخضراء ، والميتوكوندريا ، والبيروكسيسومات ، وأكسيدات غشاء البلازما NADPH ، وأكسيدازات جدار الخلية وأكسيدازات الأمين (Mittler ، 2002 Neill et al. ، 2002). تعتبر الميتوكوندريا من أهم منتجي أنواع الأكسجين التفاعلية في الخلايا الحيوانية وفي الخلايا النباتية التي لا تحتوي على البلاستيدات الخضراء ، مثل أنابيب حبوب اللقاح. يعتبر O2• - يرتبط التكوين في الميتوكوندريا ارتباطًا وثيقًا بكفاءة الاقتران بين السلسلة التنفسية والفسفرة التأكسدية. ينقل أوكسيديز NADPH المرتبط بغشاء البلازما الإلكترونات من NADPH السيتوبلازمي لتكوين O2• - ، الذي يخضع لتفاعل تفكك إنزيمي وغير إنزيمي ، ينتج على الفور H2ا2، الشكل الأكثر استقرارًا لـ ROS. تتراكم أنواع الأكسجين التفاعلية المتكونة في غشاء البلازما أخيرًا في جدران الخلايا في أنبوب حبوب اللقاح.

كمثرى (بيريوس بيريفوليا L.) من عائلة Rosaceae ، لديها نظام عدم توافق ذاتي قائم على المشيجية S-RNase (SI). باستخدام نظام في المختبر ، حدد فريقنا خصائص S-RNase التي تمنع على وجه التحديد إنبات حبوب اللقاح الذاتية واستطالة الأنبوب (Hiratsuka et al. ، 2001 Zhang and Hiratsuka ، 2000 Zhang and Hiratsuka ، 1999). في الآونة الأخيرة ، تم التأكيد على أن S-RNase يؤدي إلى إزالة بلمرة الهيكل الخلوي للأكتين وتدهور الحمض النووي لأنابيب حبوب اللقاح المولدة ذاتيًا (Liu et al. ، 2007 Wang et al. ، 2009). لتحديد ما إذا كانت النتائج في المختبر تعكس ما يحدث في الجسم الحي ، قمنا بتقييم الحمض النووي لأنابيب حبوب اللقاح بعد تلقيح مختلف. يلعب ROS دورًا مهمًا في استطالة أنبوب حبوب اللقاح كما هو مذكور أعلاه ، والهيكل الخلوي أكتين هو هدف لـ ROS في الخميرة (Perrone et al. ، 2008). وبالتالي ، توقعنا أن يحدث اضطراب ROS المترجمة على الأطراف في استجابة SI للكمثرى.


محتويات

إن استخراج الحمض النووي الريبي (RNA) في تجارب البيولوجيا الجزيئية معقد بشكل كبير بسبب وجود RNases في كل مكان وقوي والتي تؤدي إلى تدهور عينات الحمض النووي الريبي (RNA). يمكن أن تكون بعض RNases شديدة الصلابة ويصعب تعطيلها مقارنةً بتحييد DNases. بالإضافة إلى RNases الخلوية التي تم إصدارها ، هناك العديد من RNases الموجودة في البيئة. تم تطوير RNases ليكون لها العديد من الوظائف خارج الخلية في الكائنات الحية المختلفة. [5] [6] [7] على سبيل المثال ، RNase 7 ، أحد أفراد عائلة RNase A الفائقة ، يفرز بواسطة جلد الإنسان ويعمل كدفاع قوي ضد مسببات الأمراض. [8] [9] بالنسبة إلى RNases المفرزة ، قد لا يكون النشاط الأنزيمي ضروريًا حتى لوظيفة RNase المفصلة. على سبيل المثال ، تعمل RNases المناعية عن طريق زعزعة استقرار أغشية الخلايا للبكتيريا. [10] [11]

لمواجهة ذلك ، عادةً ما يتم تنظيف المعدات المستخدمة لاستخراج الحمض النووي الريبي جيدًا ، ويتم فصلها عن معدات المختبر الشائعة ومعالجتها بمختلف المواد الكيميائية القاسية التي تدمر RNases. للسبب نفسه ، يحرص المجربون بشكل خاص على عدم ترك بشرتهم العارية تلمس المعدات.


شاهد الفيديو: Avoiding RNase Contamination video (كانون الثاني 2022).