معلومة

عزل الحمض النووي الريبي- دور الأس الهيدروجيني


لماذا يذهب الحمض النووي الريبي وحده إلى المرحلة المائية عند معالجته بالفينول كلوروفورم عند درجة حموضة أقل؟ عند درجة الحموضة المحايدة أو الأساسية ، يهرب كل من الحمض النووي والحمض النووي الريبي إلى المرحلة المائية. إذن كيف يتم تأخير الحمض النووي عند درجة الحموضة الحمضية؟


الغرض من استخلاص الفينول الحمضي هو الاحتفاظ انتقائيًا بالـ RNA في الطور المائي أثناء تقسيم الحمض النووي إلى الطور العضوي أو الاندماج في الطور البيني. لقد وجدت العديد من الأشخاص على الإنترنت يقولون إن هذا يرجع إلى بروتونات فوسفات الحمض النووي بينما يظل فوسفات الحمض النووي الريبي أيونيًا ، مما يعطي قابلية ذوبان مختلفة. أنا لا أشتري هذا التفسير للأسباب التالية:

  • إن pKa لشق phosphodiester أقل بعدة أوامر من حيث الحجم من الرقم الهيدروجيني المستخدم في استخلاص الفينول الحمضي ، وبالتالي يجب نزع البوتاسيوم إلى حد كبير.
  • بالنظر إلى هياكلها المتشابهة ، فإن الاختلاف الكبير في pKa بين RNA و DNA المطلوب ليكون مفيدًا تحضيريًا ، بالنسبة لي ، يبدو غير قابل للتصديق.
  • لم أجد مثل هذه الادعاءات في الأدبيات العلمية.

خصائص الحمض النووي والحمض النووي الريبي التي تتبادر إلى الذهن والتي قد تفسر الذوبان التفاضلي هي:

  • يتم تغيير طبيعة الحمض النووي في الحمض بسبب بروتون القواعد النووية ، مما يعطي شحنة موجبة. هذه استطاع تسهيل التجميع.
  • الحمض النووي أطول بشكل عام.
  • يحتوي الحمض النووي الريبي على مجموعة هيدروكسيل 2 'تزيد من قطبية الجزيء.

دعم هذه الأسئلة الشائعة إلى حد ما من ThermoFisher:

يعتمد تقسيم الأحماض النووية في الفينول على الرقم الهيدروجيني. عند درجة الحموضة 7.0 أو أعلى ، يتم تقسيم كل من DNA و RNA إلى الطور المائي. في درجة الحموضة الحمضية (أقل من 7.0) يتم تغيير طبيعة الحمض النووي وسينتقل إلى المرحلة العضوية ، لكن الحمض النووي الريبي يبقى في المرحلة المائية.

الفيزياء الحيوية الدقيقة تهرب مني. أدرك أن هذا ليس إجابة بل تعليق طويل. اعتقدت أنه من المهم معالجة ما قد يكون مفهومًا خاطئًا في رأيي. الانتقادات موضع ترحيب.


في هذه الحالة هناك خاصيتان تحددان سلوك الحمض النووي الريبي (RNA):

  • قطبيتها
  • حموضته.

بسبب قطبيته ، يميل الحمض النووي الريبي إلى الهروب من طور الفينول كلوروفورم ؛ في الواقع ، هو علبة انتقل إلى المرحلة المائية حتى لو كان الأس الهيدروجيني متعادلًا [1] ، ولكن بكفاءة أقل مما لو كان الرقم الهيدروجيني حمضيًا. هنا تأتي الخاصية الثانية ، حموضة الحمض النووي الريبي. لهذا السبب ، عندما يكون RNA في محلول محايد ، يكون له شحنة سالبة: $ -OH $ s لمجموعة الفوسفات تنفصل إلى $ -O ^ - $ و $ H ^ + $. ومع ذلك ، لا يحدث هذا في محلول حمضي ، حيث يوجد بالفعل عدد كبير جدًا من $ H ^ + $. وهكذا ، عند الأس الهيدروجيني الأساسي ، تكون مجموعات $ -OH $ سليمة ولها شحنة محايدة ؛ هذا يعمل على استقرار النظام.
فكر في الأمر: إذا كانت المرحلة المائية عند درجة حموضة متعادلة وتمتلئ بجزيئات RNA سالبة الشحنة ، فلن تتمكن بعد فترة من دخول الجزيئات السالبة إلى هذا المحلول. من ناحية أخرى ، إذا بقيت جزيئات الحمض النووي الريبي التي تدخل الطور المائي محايدة إلكتروستاتيكيًا ، فإن عدد الجزيئات التي تدخل في المحلول سيكون محدودًا فقط من خلال توفر جزيئات الماء لحلها.

هذا هو السبب في أنك تستخدم درجة الحموضة * الحمضية ، إنها ببساطة مسألة كفاءة.

إخلاء المسؤولية: تستند هذه الإجابة إلى تعليق من OP بموجب OQ.

[1] لن تستخدم أبدًا محلول الأس الهيدروجيني العالي لاستخراج الحمض النووي الريبي لأن مثل هذه الحالة تحلل الحمض النووي الريبي.


استخراج حمض الغوانيدينيوم ثيوسيانات الفينول كلوروفورم

استخراج حمض الغوانيدينيوم ثيوسيانات الفينول كلوروفورم (مختصر AGPC) هي تقنية استخلاص سائل-سائل في الكيمياء الحيوية. يستخدم على نطاق واسع في البيولوجيا الجزيئية لعزل الحمض النووي الريبي (وكذلك الحمض النووي والبروتين في بعض الحالات). قد تستغرق هذه الطريقة وقتًا أطول من النظام المعتمد على العمود مثل التنقية القائمة على السيليكا ، ولكنها تتميز بدرجة نقاء أعلى وتتميز باسترداد عالٍ للحمض النووي الريبي: [1] عادةً ما يكون عمود الحمض النووي الريبي غير مناسب لتنقية الحمض النووي الريبي القصير (& lt 200 نيوكليوتيدات) الأنواع ، مثل siRNA و miRNA و gRNA و tRNA.

ابتكره في الأصل Piotr Chomczynski و Nicoletta Sacchi ، اللذان نشرا بروتوكولهما في عام 1987. [2] [3] تم بيع الكاشف بواسطة Sigma-Aldrich بالاسم TRI Reagent بواسطة Invitrogen تحت اسم TRIzol بواسطة Bioline مثل Trisher و Tel -اختبار STAT-60.


استخراج الحمض النووي والحمض النووي الريبي والبروتين: الماضي والحاضر

يعد استخراج الحمض النووي الريبي (DNA) والحمض النووي الريبي (RNA) والبروتين الطريقة الأساسية المستخدمة في علم الأحياء الجزيئي. يمكن عزل هذه الجزيئات الحيوية عن أي مادة بيولوجية لعمليات لاحقة أو تحليلية أو تحضيرية. في الماضي ، كانت عملية استخراج الأحماض النووية وتنقيتها معقدة ، وتستغرق وقتًا طويلاً ، وتتطلب جهدًا كثيفًا ، ومحدودة من حيث الإنتاجية الإجمالية. يوجد حاليًا العديد من الطرق المتخصصة التي يمكن استخدامها لاستخراج الجزيئات الحيوية النقية ، مثل البروتوكولات القائمة على الحلول والبروتوكولات القائمة على الأعمدة. لقد قطعت الطريقة اليدوية شوطًا طويلاً بمرور الوقت مع العديد من العروض التجارية التي تضمنت مجموعات كاملة تحتوي على معظم المكونات اللازمة لعزل الحمض النووي ، ولكن معظمها يتطلب خطوات طرد مركزي متكررة ، تليها إزالة المواد الطافية اعتمادًا على نوع العينة و معالجة ميكانيكية إضافية. تزايد الطلب على الأنظمة الآلية المصممة للمختبرات المتوسطة والكبيرة خلال السنوات الأخيرة. إنه بديل للطرق اليدوية كثيفة العمالة. يجب أن تسمح التكنولوجيا بإنتاجية عالية للعينات ، يجب أن يكون إنتاج الجزيئات الحيوية ونقاوتها وإمكانية استنساخها وقابليتها للتوسع بالإضافة إلى سرعة ودقة وموثوقية الفحص إلى أقصى حد ، مع تقليل مخاطر التلوث المتبادل.


تنقية الحمض النووي الريبي باستخدام TRIzol (كاشف TRI)

إذابة واستخلاص TRIzol هي طريقة عامة تم تطويرها مؤخرًا نسبيًا لنزع البروتين من الحمض النووي الريبي. هذه الطريقة مفيدة بشكل خاص في الحالات التي يتم فيها تخصيب الخلايا أو الأنسجة من أجل RNases الذاتية أو عندما يكون فصل الحمض النووي الريبي السيتوبلازمي عن الحمض النووي الريبي النووي غير عملي. TRIzol (أو TRI Reagent) هو محلول أحادي الطور من الفينول و guanidinium isothiocyanate الذي يذوب في نفس الوقت المواد البيولوجية ويغير طبيعة البروتين. بعد الذوبان ، تؤدي إضافة الكلوروفورم إلى فصل الطور (يشبه إلى حد كبير الاستخلاص بالفينول: كلوروفورم: كحول أيزو أميلي) ، حيث يتم استخلاص البروتين إلى الطور العضوي ، ويحل الحمض النووي في الواجهة ، ويبقى الحمض النووي الريبي في الطور المائي. لذلك ، يمكن تنقية الحمض النووي الريبي والحمض النووي والبروتين من عينة واحدة (ومن هنا جاء اسم TRIzol). يعد استخراج TRIzol أيضًا طريقة فعالة لعزل RNAs الصغيرة ، مثل microRNAs ، أو RNAs المرتبطة بالبيوي ، أو RNAs صغيرة متداخلة داخلية. ومع ذلك ، فإن TRIzol باهظ الثمن ويمكن أن يكون من الصعب إعادة تعليق كريات الحمض النووي الريبي. وبالتالي ، لا ينصح باستخدام TRIzol عندما يكون استخراج الفينول المنتظم عمليًا.


طرق استخلاص الحمض النووي

يمكن وصف طرق الاستخراج النووي على نطاق واسع إلى نوعين مختلفين:

الأساليب القائمة على الحلول

اعتمدت العديد من الطرق المبكرة لاستخراج الحمض النووي على طحن العينات البيولوجية المجمدة ، ثم مزجها مع محاليل المواد الكيميائية المصممة لتيسير تنقية الحمض النووي الريبي و / أو الحمض النووي.

1. الطرد المركزي المتدرج لكلوريد السيزيوم (مع بروميد الإيثيديوم)

تعتمد هذه الطريقة على ظاهرة الطفو والكثافة النوعية. كلوريد السيزيوم (CsCl) ملح كثيف للغاية. عندما تتعرض محاليل هذا الملح للطرد المركزي بسرعات عالية جدًا (نموذجيًا و GT100000 دورة في الدقيقة) ، يُنشئ CsCl تدرج تركيز ، حيث يتركز بدرجة عالية في أحد طرفي أو جانب أنبوب الطرد المركزي الذي هو & # 8217s فيه ، وأقل تركيزًا على الآخر. إذا تم إنهاء عملية الطرد المركزي بلطف ، مع تباطؤ جهاز الطرد المركزي ببطء ، فإن المحلول الأكثر كثافة (مع تركيز أعلى من CsCl) سوف يستقر في قاع الأنبوب ، مع الحفاظ على تدرج التركيز لبعض الوقت. الجزيئات الأخرى الذائبة في المحلول سوف تفصل نفسها وفقًا لمدى كثافتها ، مع انتقال الجزيئات الأكثر كثافة نحو قاع الأنبوب ، والجزيئات الأقل كثافة تتحرك نحو الأعلى. عندما يكون الحمض النووي في وجود جزيء يسمى بروميد إيثيديوم ، فإنه سوف يرتبط به ويصبح مشعًا عندما يكون تحت ضوء الأشعة فوق البنفسجية. يضبط بروميد الإيثيديوم أيضًا كثافة الحمض النووي بحيث يتحرك نحو مركز الأنبوب عند الطرد المركزي. ستنتقل الملوثات إلى مواقع مختلفة ، وبالتالي سيتم فصلها عن الحمض النووي ، والذي يمكن رؤيته واستعادته بسهولة لأنه سيكون متوهجًا. ستفصل الخطوات اللاحقة بعد ذلك الحمض النووي عن CsCl وبروميد الإيثيديوم. هذه التقنية فعالة بشكل خاص لفصل البلازميدات & # 8211 وهي سلاسل DNA صغيرة تستخدمها البكتيريا لمشاركة المعلومات حول مقاومة المضادات الحيوية مع بعضها البعض ، والحمض النووي للميتوكوندريا ، وجزيئات الحمض النووي الأخرى المحددة التي ترتبط بكميات مميزة من بروميد الإيثيديوم ، وبالتالي سوف لها كثافة فريدة. من السهل فصل الحمض النووي للميتوكوندريا والبلازميد. يتم ترتيب هذه الأحماض النووية في أنماط دائرية ملفوفة للغاية (تسمى فائقة الالتفاف). يرتبط الحمض النووي غير الملفوف (مثل أنواع الحمض النووي الصبغية الأطول) بكميات مختلفة من بروميد الإيثيديوم ، وله كثافة مختلفة & # 8211 مما يسهل فصلها عن DNA البلازميد.

2. غوانيدينيوم ثيوسيانات - فينول - كلوروفورم استخراج الحمض النووي

يسمح محلول مائي من ملح غوانيدينيوم ثيوسيانات ، عند مزجه مع المذيبات الفينول والكلوروفورم ، بتنقية RNA بفعالية من خلال عدد قليل من الخطوات. عندما يتم طحن العينات وخلطها مع الكلوروفورم والفينول وخلات الصوديوم وجوانيدينيوم ثيوسيانات ، وتعريضها للطرد المركزي ، سينفصل محلول الملح عن المذيبات & # 8211 لتوفير طور مائي علوي وطور عضوي سفلي يتكون من المذيبات. سيبقى الحمض النووي الريبي في المرحلة المائية ، بينما تنتقل البروتينات والأحماض النووية الأخرى والملوثات الأخرى إلى المرحلة العضوية أو إلى الواجهة بين المرحلتين.

3. استخراج الحمض النووي Cetyltrimethylammonium بروميد

تستخدم هذه التقنية في الغالب لعينات النباتات وكذلك أجزائها مثل الحبوب والبذور والأوراق. كما أنها تستخدم في العديد من عينات الطعام. الأحماض النووية وبعض السكريات الأخرى غير قابلة للذوبان في محاليل 2٪ من استخلاص الحمض النووي بروميد سيتيل ترايميثيل الأمونيوم (CTAB) ، عند درجة حموضة عالية. السكريات والبروتينات المحايدة قابلة للذوبان. يوفر هذا طريقة سهلة لإزالة العديد من الملوثات النباتية الصعبة قبل مزيد من التنقية.

4. استخراج Chelex®

تستخدم هذه التقنية في مجال الطب الشرعي لاستخراج الحمض النووي من مصادر مختلفة مثل مسحات الشدق وبطاقات الدم والشعر. تستخدم هذه الطريقة الراتنج (تجارة تسمى Chelex®، التي ترتبط بالمثبطات الشائعة لعملية تفاعل البلمرة المتسلسل (PCR). ينتج عن هذا عينة خام إلى حد ما ، ولكنها تحافظ على الحمض النووي وتجعله مفيدًا لتحليل الطب الشرعي القائم على تفاعل البوليميراز المتسلسل.

5. استخراج القلوية

تُستخدم هذه التقنية لعزل DNA البلازميد ، بمفردها لتحضيرات خام نسبيًا ، أو كخطوة أولى في جميع عمليات تنقية البلازميد تقريبًا. إنه ينطوي على حصاد البكتيريا ذات الأهمية من وسط الاستزراع وبالتالي تعريض البكتيريا لمحلول قلوي للغاية. يتبع ذلك عمومًا خلط المستخلص القلوي مع المنظف Sodium Dodecyl Sulfate ، الذي يزيل البروتينات ومعظم الملوثات الأخرى. تتمثل إحدى أكبر مزايا هذه الطرق في أنه نظرًا لوجود العديد من البروتينات المرتبطة بالحمض النووي الصبغي الكبير ، تتم إزالة هذا الحمض النووي جنبًا إلى جنب مع البروتينات. نظرًا لأن تقنيات الاستنساخ الجزيئي تعتمد على معالجة DNA البلازميد ، فإن إزالة الحمض النووي الصبغي أمر بالغ الأهمية.

استخراج الحمض النووي في المرحلة الصلبة

تعمل طرق استخلاص الطور الصلب عن طريق التسبب في ارتباط الأحماض النووية بالدعامات الصلبة ، مثل الحبيبات المغناطيسية المطلية بالسيليكا أو المواد الأخرى. ثم يتم غسل الحبيبات (أو الدعامات الأخرى) بالكحول لإزالة الملوثات. يتم بعد ذلك غسل الدعامة بسائل يجعل الأحماض النووية قابلة للذوبان مرة أخرى ، مما يحرر الحمض النووي من الدعم في عملية تعرف باسم الشطف. طريقة بسيطة هي إضافة محلول يحتوي على Chaotrope إلى مستخلص الحمض النووي الخام. عوامل Chaotropic هي جزيئات تعطل شبكة الترابط الهيدروجيني بين جزيئات الماء. في وجود Chaotropes ، فإن الأحماض النووية أقل قابلية للذوبان بكثير وسوف ترتبط بالزجاج والخرز المغناطيسي المطلي بالسيليكا وغيرها من الدعامات الصلبة & # 8211 مما يسهل فصلها عن الملوثات. يمكن أن تعتمد طرق استخراج المرحلة الصلبة أيضًا على الارتباط الانتقائي للحمض النووي والحمض النووي الريبي براتنجات التبادل الأيوني أو مواد كيميائية أخرى.


أساليب

زراعة الخلايا

تم نشر خلايا MDCK-London 14 باستخدام DMEM (Mediatech ، Inc.) مع 10 ٪ من مصل بقري جنيني (Hyclone) و 2 ملي مولار جلوتامين. تم إجراء العدوى بفيروس الأنفلونزا (A / Brisbane / 59/2007) في وسط عدوى يتكون من DMEM المضاف إليه الجلوتامين (2 مم) و HEPES (25 مم) وألبومين مصل الأبقار (0.2٪ A7888 Sigma) و TPCK-trypsin ( 1 ميكروغرام / مل T1426 سيجما). بالنسبة للتجارب التي تستخدم تنسيق لوحة 24 خلية بئر ، تم خلط تعليق من خلايا التربسين (غسلها جيدًا لإزالة 300000 خلية / بئر من المصل) بالفيروس (10000 TCID50/ بئر) في وسط الإصابة (1 مل / بئر). تم السماح للخلايا بالالتصاق وتم تحضير محللات الخلية في 6 ساعات بعد الإصابة.

إعداد ليسيتس خلية جاهزة RT-qPCR

تم غسل خلايا MDCK-London في 24 طبقًا جيدًا مرة واحدة باستخدام PBS (1 مل / بئر). تم تحضير محلول الخلية عن طريق تعريض الطبقة الأحادية الخلية إلى 200 ميكرولتر / بئر من كاشف تحضير عينة Bio-Rad iScript (يشار إليه باسم Bio-Rad SPR 170-8898) أو محلول الخلية (CL). تكونت الصيغة النهائية لـ CL Buffer من 10 ملي مولار Tris-HCl pH 7.4 ، 0.25٪ Igepal CA-630 و 150 ملي مول كلوريد الصوديوم. تم تحضير CL Buffer حديثًا من حلول المخزون التالية في يوم التجربة: 1 M Tris-HCl (T2194 Sigma) و 10٪ Igepal CA-630 (I8896 Sigma) و 5 M NaCl (351-036-100 Quality Biological، Inc) .). كانت جميع الكواشف عبارة عن درجة بيولوجيا جزيئية وتم إجراء التخفيفات باستخدام الماء المعالج بـ DEPC (351-068-721 Quality Biological ، Inc.). بالنسبة لتجارب معينة ، تضمن CL Buffer أيضًا MgCl2 (M1028 Sigma) أو مثبط RNasin Plus RNase (N2615 Promega). تمت معايرة كل من Bio-Rad SPR و CL Buffer مع درجة حرارة الغرفة قبل الاستخدام. تم تعريض الخلايا للأوقات المحددة (عادةً دقيقتان لـ Bio-Rad SPR و 5 دقائق لـ CL Buffer). تم جمع المحللات الناتجة بعناية دون إزعاج بقايا الطبقة أحادية الطبقة وإما تم تحليلها على الفور أو تخزينها مجمدة (-20 درجة مئوية أو -80 درجة مئوية).

تحليل RT-qPCR للتعبير الجيني لمصفوفة فيروس الأنفلونزا

تم تصميم التجارب لتكون متوافقة مع إرشادات MIQE 15. تم إجراء تحليل RT-qPCR كما هو موضح في دراسة سابقة 1. تم استخدام بادئات PCR (إلى الأمام: AAGACCAATCCTGTCACCTCTGA معكوسة: CAAAGCGTCTACGCTGCAGTCC) تضخيم منطقة 104 نقطة أساس محفوظة للغاية من جين المصفوفة لفيروسات الأنفلونزا A 16 في خطوة واحدة SYBR Green RT-qPCR. احتوى كل تفاعل على: قالب (1 ميكرولتر من محلول الخلية) ، 1 × iScript من خطوة واحدة SYBR Green RT-PCR Supermix (170-8893 Bio-Rad) ، 600 نانومتر من كل تمهيدي (تم تصنيعه في مرفق موارد التكنولوجيا الحيوية CBER ، FDA Bethesda ، MD) والمياه الخالية من نوكلياز حتى 10 ميكرولتر. تم استخدام أداة PCR في الوقت الحقيقي CFX96 (Bio-Rad) مع البروتوكول التالي: 50 درجة مئوية لمدة 10 دقائق (1 ×) ، 95 درجة مئوية لمدة 5 دقائق (1 ×) ، 95 درجة مئوية لمدة 10 ثوان / 61 درجة C لمدة 15 ثانية / 72 درجة مئوية لمدة 30 ثانية (40 ×) حدث جمع البيانات بعد خطوة التمديد 72 درجة مئوية. تم استخدام إجمالي الحمض النووي الريبي المنقى من خلايا MDCK-London المصابة بسلالة فيروس الأنفلونزا A / PR / 8/34 كمعيار كمي RT-qPCR كما هو موضح سابقًا 1. لكل تشغيل RT-qPCR ، تم تقييم سلسلة تخفيف 10 أضعاف من المعيار (باستخدام محلول الخلية المحضر من الخلايا غير المصابة كمخفف) في تكرار على الأقل من أجل التحقق من صحة أداء RT-qPCR وتسهيل القياس الكمي. بالإضافة إلى ذلك ، تضمن كل تشغيل RT-qPCR عناصر تحكم سلبية (محللة غير مصابة كمدخلات) وعناصر تحكم النسخ غير العكسي (التخفيف الأولي لمعيار RNA الموصوف أعلاه كمدخلات) تؤدي عناصر التحكم هذه عادةً إلى عدم تضخيم أو تضخيم غير محدد منخفض المستوى (مقترح بتحليل منحنى الذوبان) باستخدام Cفs & gt 36. من المهم أن نلاحظ أنه لا توجد وسيطات DNA في دورة حياة فيروس الأنفلونزا.

التقييم القائم على الموائع الدقيقة للحمض النووي الريبي

تمت تنقية إجمالي الحمض النووي الريبي من محللات الخلية باستخدام مجموعة RNeasy Mini (Qiagen) وفقًا لبروتوكول "التنظيف" المزود مع المجموعة. بدءا من

تمت إضافة 200 ميكرولتر من محلول الخلية ، و 700 ميكرولتر من المخزن المؤقت RLT و 500 ميكرولتر من الإيثانول ، وتم تمرير الخليط عبر عمود دوران RNeasy Mini. باتباع خطوات الغسيل الموصوفة ، تمت إزالة الحمض النووي الريبي المنقى في 30 ميكرولتر من الماء الخالي من نوكلياز وتخزينه عند درجة حرارة -80 درجة مئوية حتى التقييم. تعرضت عينات الحمض النووي الريبي المنقى (1 ميكرولتر) لتحليل Experion RNA StdSens المعتمد على الموائع الدقيقة (Bio-Rad) وفقًا لبروتوكول الشركة المصنعة للنظام. تراوحت تركيزات عينة الحمض النووي الريبي ، كما تم قياسها بواسطة Experion ، عادةً من 100-300 نانوغرام / ميكرولتر (ضمن نطاق التركيز الموصى به من 5 إلى 500 نانوغرام / ميكرولتر لشريحة StdSens).

مقايسة تحييد الميكروني المستندة إلى RT-qPCR لفيروس الأنفلونزا

تم إجراء تحييد الميكرون لفيروس الأنفلونزا كما هو موضح سابقًا 1. تم الحصول على عينة من مصل الإنسان 17 من فرد له تاريخ في التطعيم ضد الإنفلونزا من W. Wang و C. Weiss (قسم المنتجات الفيروسية ، CBER ، FDA). تم الحصول على عينة المصل بموافقة مستنيرة مكتوبة بعد الموافقة الأخلاقية من قبل لجنة البحوث التي تنطوي على البشر (RIHSC) في إدارة الغذاء والدواء الأمريكية. تم تعطيل حرارة عينة المصل بالحضانة عند 56 درجة مئوية لمدة 30 دقيقة قبل الاستخدام. أجريت تجارب معادلة باستخدام وسط الإصابة. لقاح الفيروس (1000 TCID50/ 50 ميكرولتر) مع تخفيف من المصل (50 ميكرولتر) في بئر من 96 لوحة ثقافة جيدا. بعد الحضانة لمدة ساعة عند 37 درجة مئوية ، تمت إضافة تعليق خلايا MDCK-London (30000 خلية / 100 ميكرولتر). في 6 ساعات بعد الإصابة ، تم تحضير محللات الخلية عن طريق غسل الخلايا مرة واحدة باستخدام PBS وإضافة 100 ميكرولتر / بئر من Bio-Rad SPR أو CL Buffer معادل لخلايا درجة حرارة الغرفة وتم تعريضها لمدة دقيقتين (Bio-Rad SPR) أو 5 دقائق (CL Buffer). تم جمع Lysates وتخزينها مجمدة عند درجة حرارة -20 درجة مئوية (عينات Bio-Rad SPR) أو -80 درجة مئوية (عينات CL Buffer) حتى التقييم. تم تحديد كمية تكاثر الفيروس ، كما ينعكس في التعبير الجيني للمصفوفة ، عن طريق إخضاع المحللة (1 ميكرولتر) للتحليل بواسطة RT-qPCR. تم تطبيع كمية الحمض النووي الريبي في كل عينة تجريبية مقابل القيمة المتوسطة (ن ≥ 3) التي تم الحصول عليها من آبار التحكم التي أصيبت فيها الخلايا في غياب مصل معادل (آبار مكافحة الفيروسات). تم تحديد عيار التحييد كمقابل لأعلى تخفيف مصل (قبل إضافة الفيروس أو الخلايا) مما أدى إلى تثبيط 90 ٪ على الأقل من إشارة RT-qPCR.


تقييم جودة عينة الحمض النووي

تتنوع إجراءات معالجة العينات واستخراج الحمض النووي ، لذلك من الأهمية بمكان تحديد بروتوكول موثوق لتحليل جودة العينة وكميتها وتضمين تفاصيل هذا التحليل في المنشورات 2. يتم تحديد كمية الحمض النووي الريبي إلى حد كبير من خلال إنتاجية الحمض النووي الريبي ، في حين يتم تحديد جودة الحمض النووي الريبي من خلال نقاء (عدم وجود مثبطات) وسلامة جزيئات الحمض النووي الريبي. ومع ذلك ، عند قياس جودة العينة ، يؤثر النقاء والسلامة على النتائج ، من الصعب تحديد نقاء وسلامة عينة ذات تركيز منخفض ويمكن أن يتداخل وجود الشوائب مع القياس الكمي. هناك عدد من التقنيات التي يمكن استخدامها لتقييم كمية الحمض النووي وجودته ، ولكن لا توفر أي منها ، وحدها ، جميع المعلومات المطلوبة لوصف العينة بشكل كامل. لذلك ، من المهم النظر في مجموعة من الخيارات للتأكد من أن جودة العينة لن تؤثر على بيانات التحليل النهائية 1.

تحديد كمية الحمض النووي

التحليل الطيفي للأشعة فوق البنفسجية

تم تحديد كمية الأحماض النووية تقليديًا عن طريق قياس امتصاص الأشعة فوق البنفسجية باستخدام مقياس الطيف الضوئي. تتم قراءة امتصاص عينة مخففة من DNA أو RNA عند 260 نانومتر و 280 نانومتر. تُستخدم الكثافة البصرية (OD) عند 260 نانومتر لتحديد تركيز الحمض النووي الريبي أو الحمض النووي في محلول باستخدام قانون بير لامبرت ، والذي يتنبأ بوجود ارتباط خطي بين الامتصاص والتركيز.

قانون بير لامبرت

أ = εbc
أ = الامتصاصية
ب = طول مسار الكوفيت بالسنتيمتر (عادة 1 سم)
ج = تركيز المادة التحليلية
ε = معامل الانقراض

بالنسبة للحمض النووي الريبي ، ε = 40 ميكروغرام / مل
بالنسبة للحمض النووي ، ε = 50 ميكروغرام / مل

OD عند 260 نانومتر (أ260) قراءة 1.0 تعادل ما يقرب من 40 ميكروغرام / مل من الحمض النووي الريبي النقي و 50 ميكروغرام / مل من الحمض النووي المزدوج الشريطة النقي. ومع ذلك ، فإن قانون Beer-Lambert صالح فقط لقراءات OD حتى 2 وتعتمد علاقة OD / التركيز المذكورة على أن العينات نقية. من الواضح أن المواد الملوثة بامتصاص 260 نانومتر أو 280 نانومتر ستؤثر على قراءة OD المقدرة. يحتوي الحمض النووي الريبي النقي على A260280 من 2.1 ، في حين أن الحمض النووي النقي سيكون له A260280 من 1.8.

يمكن أيضًا تحديد OD للمواد التي يحتمل أن تكون ملوثة مثل البروتينات والأملاح الغذائية والفينول إذا تم قياس امتصاص العينة عند 280 نانومتر و 230 نانومتر (A280 و أ230, على التوالى). بهذه الطريقة ، تكون النسبة أ260280 و أ260230 يمكن استخدامها كمؤشر على نقاء العينة. ومع ذلك ، تجدر الإشارة إلى أن تحديد تلوث البروتين في الحمض النووي غير حساس للغاية عند استخدام هذا النهج 4.

بالإضافة إلى ذلك ، فإن الأس الهيدروجيني والقوة الأيونية للمخزن المؤقت تزعج أيضًا قراءة OD. لقد ثبت أن هناك تباينًا كبيرًا في A260280 النسبة عند استخدام مصادر مختلفة من المياه لأداء القياسات الطيفية. على سبيل المثال ، أدى الاختلاف في درجة حموضة الماء بين الرقم الهيدروجيني 5.4 إلى 7.5-8.5 المستخدم لتعليق الحمض النووي الريبي إلى زيادة كبيرة في الحمض النووي الريبي A260280 النسب من حوالي 1.5 إلى 2.0 5.

من المهم أن كلا من A260280 النسبة و A.260230 النسب قريبة من 2.0 (الجدول 7.1).

تلوث TRIS والإيثانول والأيزوبروبانول

تأثير تلوث TRIS: لا يؤثر تلوث TRIS على طيف الامتصاص لـ RNA / DNA بشكل كبير.

تأثير تلوث الإيثانول: لا يؤثر الإيثانول بشكل كبير على طيف الامتصاص من الحمض النووي الريبي / الحمض النووي عند قياسه في درجة الحموضة 8.0. ومع ذلك ، عندما يتم القياس في الماء النقي ، فإن A260280 قد يتم تقليل النسبة وبالتالي قد تشير النسبة الأقل من 2.0 إلى تلوث بالإيثانول.

تأثير تلوث الأيزوبروبانول: ليس للأيزوبروبانول تأثير كبير على طيف الامتصاص من RNA / DNA عند قياسه في TE pH 8.0. ومع ذلك ، عندما يتم القياس في الماء النقي ، فإن A260280 يمكن تقليل النسبة وبالتالي فإن النسبة الأقل من 2.0 قد تشير إلى تلوث الأيزوبروبانول.

تلوث البروتين ، غوانيدين أيزوثيوسيانات والفينول

تأثير تلوث البروتين: عينة تحتوي على تلوث بنسبة 0.01٪ مساحة سطح الجسم يمكن أن تظهر طيف امتصاص طبيعي تقريبًا ، على الرغم من أن A260280 قد تنخفض النسبة إلى أقل من 1.9 (RNA) أو 1.7 (DNA) ، وهو تحذير من أن شيئًا ما يلوث العينة. عند 0.5٪ من مساحة سطح الجسم ، تبدو أطياف الامتصاص غير طبيعية وهذا مؤشر واضح على وجود مستوى كبير من التلوث في العينة. لذلك ، يمكن اكتشاف تركيزات عالية من البروتين عن طريق A غير الطبيعي260280 النسب ولكن الكميات المنخفضة والمتوسطة ليست كذلك.

تأثير تلوث غوانيدين أيزوثيوسيانات: Guanidine isothiocyanate له تأثير ضئيل على A.260280 نسبة ، لذلك ، غوانيدين isothiocyanate لها تأثير صغير على القياس الكمي للحمض النووي الريبي. ومع ذلك ، فإن وجود غوانيدين isothiocyanate له تأثير قوي للغاية على A.260230 نسبة تلوث 0.5٪ ، A260230 تنخفض النسبة إلى أقل من 0.5. يجب تجنب العينات المشتبه بتلوثها بجوانيدين لأن هذا سيكون له تأثير ضار على التفاعلات الأنزيمية في اتجاه مجرى النهر.

تأثير تلوث الفينول: الفينول له تأثير قوي جدا على القياس الكمي للحمض النووي الريبي. عند تلوث 0.5٪ بالفينول لعينة من الحمض النووي الريبي عند 50 نانوغرام / ميكرولتر ، يكون التركيز المقاس أعلى بثلاث مرات. هذا التأثير المزعج القوي للفينول على القياس الكمي للحمض النووي الريبي يرجع إلى ذروة الامتصاص الملوثة عند 270 نانومتر. عند تركيزات منخفضة جدًا من الحمض النووي الريبي ، أقل من 10 نانوغرام / ميكرولتر ، غالبًا ما يتم الخلط بين هذه الذروة الملوثة للحمض النووي الريبي. ومع ذلك ، فإن امتصاص الحمض النووي الريبي يكون دائمًا عند 260 نانومتر وليس عند 270 نانومتر ، لذلك إذا كانت الذروة عند 270 نانومتر ، فهذا يرجع إلى التلوث. بعد عزل الحمض النووي الريبي باستخدام طريقة تعتمد على الفينول ، فإن التقدير الزائد الخاطئ لتركيز الحمض النووي الريبي يمثل مشكلة خطيرة. هذا هو الحال بشكل خاص عندما يكون الحمض النووي الريبي منخفض التركيز.

قياس الطيف الضوئي الآلي للأشعة فوق البنفسجية

في حين أن الرحلان الطيفي التقليدي للأشعة فوق البنفسجية يتطلب إجراء قياسات باستخدام كميات كبيرة نسبيًا من العينة ، هناك الآن أنظمة مثل مقياس الطيف الضوئي NanoDrop ® 2000 UV-Vis الذي يتم تشغيله تلقائيًا ويدعم التحليلات الدقيقة للغاية لأحجام العينات الصغيرة للغاية. تلغي أنظمة الاحتفاظ بالعينة الحاجة إلى الأوعية والشعيرات الدموية ، مما يقلل من كمية العينة التي تم تحليلها إلى ما بين 0.5 ميكرولتر و 2 ميكرولتر. يوفر NanoDrop مسحًا للامتصاصية من حوالي 200 نانومتر إلى 350 نانومتر ، وهي المنطقة ذات الصلة لتحديد تركيز RNA / DNA ونقاوتها.

نظم تحديد كمية الأحماض النووية المستندة إلى الإسفار

استخدام الأصباغ الفلورية لقياس الأحماض النووية هو بديل للامتصاص الطيفي 6،7. يستخدم تحديد تركيز الحمض النووي باستخدام طرق الفلورسنت ربط الجزيئات الصغيرة أو الأصباغ بالأحماض النووية ويقيس التغييرات اللاحقة في خصائص التألق. على الرغم من أنه أكثر تكلفة من القياس الطيفي للامتصاص ، إلا أن القياس الكمي المستند إلى الفلورة أكثر حساسية ودقة وقد يكون محددًا للحمض النووي محل الاهتمام.

نظرًا لأن مقاييس التألق تقيس التألق في وحدات نسبية بدلاً من وحدات مطلقة ، يتم معايرة القياس أولاً بتركيز معروف لمحلول حمض نووي قياسي بخصائص مشابهة للعينة المراد قياسها. بعد المعايرة ، يمكن أن يحدد قياس واحد تركيز الحمض النووي في المحلول ، ولكن عادةً ما يلزم وجود منحنى قياسي للتأكد من خطية الفحص في النطاق المقاس.

يمكن استخدام الأنظمة الآلية مثل مقياس التألق QuBit® 2.0 (تقنيات الحياة) مع مجموعة مختلفة من فحوصات القياس الكمي القائمة على التألق لقياس تركيز الحمض النووي في المحلول. تظهر الاختبارات نطاقًا ديناميكيًا واسعًا للكشف وقادرة على تحليل العينات الصغيرة بدقة.

من الأهمية بمكان ملاحظة أن قراءة OD هي مقياس للامتصاص ولا يمكن استخدامها كتقييم كامل لجودة العينة. وبالمثل ، توفر الأنظمة المعتمدة على الفلورسنت مقياسًا للكمية وليس الجودة. على سبيل المثال ، لا يمكن استخدام هذه الاختبارات كاختبار لسلامة العينة ويجب أيضًا إجراء تحليل مناسب ، مثل الرحلان الكهربائي الشعري ، أو تحليل الهلام ، أو مقايسة النسبة 3/5 (كما هو موضح أدناه).


مراحل الطريقة هي الليز ، والربط ، والغسيل ، والتقطير. [1] [2] بشكل أكثر تحديدًا ، يستلزم هذا تحلل الخلايا المستهدفة لإطلاق الأحماض النووية ، والربط الانتقائي للحمض النووي بغشاء السيليكا ، وإزالة الجسيمات والمثبطات غير المرتبطة بغشاء السيليكا ، وتصفية النواة ، والنتيجة النهائية هي حمض نووي منقى في محلول مائي.

من أجل التحلل ، يجب أن تخضع الخلايا (الدم ، الأنسجة ، إلخ) للعينة لعلاج لكسر غشاء الخلية وتحرير الحمض النووي. اعتمادًا على المادة المستهدفة ، يمكن أن يشمل ذلك استخدام المنظفات أو المحاليل المنظمة الأخرى ، أو البروتينات أو الإنزيمات الأخرى ، أو التسخين لأوقات / درجات حرارة مختلفة ، أو التعطيل الميكانيكي مثل القطع بسكين أو المجانسة ، باستخدام ملاط ​​ومدقة ، أو حبة- الضرب بمطحنة حبة.

للربط ، يضاف محلول منظم بعد ذلك إلى العينة المفسدة مع الإيثانول أو الأيزوبروبانول. يتم بعد ذلك نقل العينة في محلول الربط إلى عمود دوران ، ويتم وضع العمود إما في جهاز طرد مركزي أو إرفاقه بفراغ. يدفع جهاز الطرد المركزي / الفراغ المحلول عبر غشاء السيليكا الموجود داخل عمود الدوران ، حيث في ظل الظروف الأيونية الصحيحة ، سوف ترتبط الأحماض النووية بغشاء السيليكا ، حيث يمر باقي المحلول من خلاله. مع ربط المادة المستهدفة ، يمكن إزالة التدفق.

للغسيل ، يتم إضافة مخزن مؤقت جديد إلى العمود ، ثم يتم طرده / تفريغه من خلال الغشاء. يهدف هذا المخزن المؤقت إلى الحفاظ على ظروف الربط ، مع إزالة أملاح الربط وغيرها من الملوثات المتبقية. بشكل عام ، يستغرق الأمر عدة عمليات غسل ، غالبًا بنسب متزايدة من الإيثانول / الأيزوبروبانول ، حتى يصبح الحمض النووي الموجود على غشاء السيليكا خاليًا من الملوثات. غالبًا ما يكون "الغسيل" الأخير خطوة جافة للسماح للكحول بالتبخر ، تاركًا فقط الأحماض النووية المنقاة مرتبطة بالعمود.

أخيرًا ، الشطف هو عملية إضافة محلول مائي إلى العمود ، مما يسمح للحمض النووي المحب للماء بمغادرة العمود والعودة إلى المحلول. يمكن تحسين هذه الخطوة بالملح أو درجة الحموضة أو الوقت أو الحرارة. أخيرًا ، لالتقاط الشطف / الشطف ، يتم نقل العمود إلى أنبوب دقيق نظيف قبل خطوة الطرد المركزي الأخيرة.

حتى قبل استخدام طرق الأحماض النووية المستخدمة اليوم ، كان معروفًا أنه في وجود عوامل تشوشية ، مثل يوديد الصوديوم أو فوق كلورات الصوديوم ، يرتبط الحمض النووي بالسيليكا أو جزيئات الزجاج أو الطحالب أحادية الخلية التي تسمى الدياتومات التي تحمي جدرانها الخلوية بالسيليكا. تم استخدام هذه الخاصية لتنقية الحمض النووي باستخدام مسحوق الزجاج أو حبيبات السيليكا تحت ظروف قلوية. [3] تم تحسين هذا لاحقًا باستخدام ثيوسيانات الغوانيدينيوم أو هيدروكلوريد الغوانيدينيوم كعامل شوتروبي. [4] لسهولة التعامل ، تم تغيير استخدام الخرز الزجاجي لاحقًا إلى أعمدة السيليكا. ولتمكين استخدام أدوات الاستخراج الأوتوماتيكية ، كان هناك تطوير لحبيبات مغناطيسية مغطاة بالسيليكا ، يشار إليها بشكل أكثر شيوعًا باسم استخراج "الخرزة المغناطيسية".


الحمض النووي أكثر قابلية للذوبان في مرحلة الماء

إذن ما علاقة هذا بفصل الحمض النووي والبروتين؟

حسنًا بشكل عام ، تذوب المركبات القطبية (المشحونة) بشكل أفضل في المذيبات القطبية وتذوب الجزيئات غير القطبية بشكل أفضل في المذيبات الأقل قطبية أو غير القطبية.

الحمض النووي هو جزيء قطبي بسبب الشحنات السالبة الموجودة على العمود الفقري للفوسفات ، لذلك فهو قابل للذوبان في الماء بشدة وأقل في الفينول. هذا يعني أنه عندما يتم خلط الماء (+ DNA + البروتين) والفينول في البروتوكول ، لا يذوب الحمض النووي في الفينول ، ولكنه يبقى في مرحلة الماء.


ما الذي يصنع عازلة جيدة؟

في عام 1966 ، شرع نورمان جود وزملاؤه في تحديد أفضل المحاليل المعيارية للأنظمة الكيميائية الحيوية (جيد وآخرون. 1966). وضع جيد عدة معايير لمثل هذه المخازن المؤقتة:

  • أ pKأ بين 6 و 8. معظم التجارب البيوكيميائية لها درجة حموضة مثالية في نطاق 6 & ndash8. نطاق التخزين المؤقت الأمثل للمخزن المؤقت هو ثابت التفكك للمكون الحمضي الضعيف للمخزن المؤقت (pKأ) زائد أو ناقص وحدة الأس الهيدروجيني.
  • الذوبان في الماء. تحدث التفاعلات البيولوجية ، في معظمها ، في البيئات المائية ، ويجب أن يكون المخزن المؤقت قابلًا للذوبان في الماء لهذا السبب.
  • الاستبعاد بواسطة الأغشية البيولوجية. هذا ليس مهمًا لجميع التفاعلات الكيميائية الحيوية. However, if this is an important criterion for your particular experiment, it is helpful to remember that zwitterionic buffers (positive and negative charges on different atoms within the molecule) do not pass through biological membranes. Examples of zwitterionic buffers include MOPS and HEPES Tris and phosphate buffers do not isomerize into zwitterions.
  • Minimal salt effects. In other words, the buffer components should not interact or affect ions involved in the biochemical reactions being explored.
  • Minimal effects on the dissociation from changes in temperature and concentration. Usually there is some change in the dissociation with a change in concentration. If this change is small, stock solutions usually can be diluted without changing the pH. However, with some buffers, changes in concentration have more effect on dissociation, and stock solutions cannot be diluted without significantly affecting pH.
    For instance, the pH of Tris decreases approximately 0.1 pH unit per tenfold dilution, and the pH could change dramatically if you dilute a working solution and are at the limits of the optimal buffering range of the Tris (optimal buffering range pH 7.3&ndash9.3 at 20°C). Note that Tris is not one of Good&rsquos buffers.
    Temperature changes can be a problem too. Tris exhibits a large shift in dissociation with a change in temperature. For example, if you prepare a Tris buffer at pH 7.0 at 4.0°C and perform a reaction in that same buffer at 37°C, the pH will drop to 5.95.
    If you have a Tris buffer prepared at 20°C with a pKأ of 8.3, it would be an effective buffer for many biochemical reactions (pH 7.3&ndash9.3), but the same Tris buffer used at 4°C becomes a poor buffer at pH 7.3 because its pKأ shifts to 8.8.
    So the take-home message: Make the buffer at the temperature you plan to use it, and if your experiment involves a temperature shift, select a buffer with a range that can accommodate any shift in dissociation as a result.
  • Minimal interactions between buffer components and critical reaction components. If a complex forms between the buffer and a required cofactor, say a metal cation like zinc or magnesium, your reaction also might be compromised. For example calcium precipitates as calcium phosphate in phosphate buffers. Not only would any Ca 2+ -requiring reactions be compromised, but the buffering capacity of the phosphate buffer also is affected.
    Having excessive amounts of a chelating agent in the buffer for an enzymatically driven reaction could cause problems (e.g., a high concentration of EDTA in a PCR amplification). Citrate is a calcium chelator, so avoid citrate buffers in situations where calcium concentrations are critical.
    Tris buffers again give us problems because Tris contains a reactive amine group. If you are trying to make Tris buffer that is RNase-free, the amine group on the Tris molecule will react with diethylpyrocarbonate (DEPC), the chemical typically used to pretreat aqueous solutions used for RNA work. So, do not DEPC-treat Tris-containing solutions. HEPES is another buffer that reacts with DEPC. (Remember too, that MOPS is a much better buffer for most RNA work!)
    Take-home message: Buffers are not inert. Be careful which ones you chose.
  • Chemical stability. The buffer should be stable and not break down under working conditions. It should not oxidize or be affected by the system in which it is being used. Try to avoid buffers that contain participants in reactions (e.g., metabolites).
    Some buffers, such as MOPS, must be protected from light, but when they are stored properly they are still extremely useful buffers in biochemical reactions and laboratory protocols like RNA electrophoresis.
  • Light absorption. The buffer should not absorb UV light at wavelengths that may be used for readouts in photometric experiments.
  • Ease of Use. The buffer components should be easy to obtain and prepare.

حسن وآخرون. defined several characteristics of buffers for biochemical reactions. No matter what buffer you choose, you need to consider effects of temperature and environment on the buffer and ensure that the buffer is compatible with your system.


Introduction to Single-Cell RNA Sequencing

During the last decade, high-throughput sequencing methods have revolutionized the entire field of biology. The opportunity to study entire transcriptomes in great detail using RNA sequencing (RNA-seq) has fueled many important discoveries and is now a routine method in biomedical research. However, RNA-seq is typically performed in "bulk," and the data represent an average of gene expression patterns across thousands to millions of cells this might obscure biologically relevant differences between cells. Single-cell RNA-seq (scRNA-seq) represents an approach to overcome this problem. By isolating single cells, capturing their transcripts, and generating sequencing libraries in which the transcripts are mapped to individual cells, scRNA-seq allows assessment of fundamental biological properties of cell populations and biological systems at unprecedented resolution. Here, we present the most common scRNA-seq protocols in use today and the basics of data analysis and discuss factors that are important to consider before planning and designing an scRNA-seq project. © 2018 by John Wiley & Sons, Inc.

الكلمات الدالة: RNA sequencing gene expression profiling single-cell analysis.


شاهد الفيديو: كيف تتخصص الخلايا برمجة الخلايا والحمض النووي micro RNA (كانون الثاني 2022).